ID: 1057083064

View in Genome Browser
Species Human (GRCh38)
Location 9:92187277-92187299
Sequence TCAAGGACTTTCCTGGCACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057083064_1057083071 25 Left 1057083064 9:92187277-92187299 CCTAGTGCCAGGAAAGTCCTTGA No data
Right 1057083071 9:92187325-92187347 ATTTTACACAAGAGGAGCTCTGG No data
1057083064_1057083068 17 Left 1057083064 9:92187277-92187299 CCTAGTGCCAGGAAAGTCCTTGA No data
Right 1057083068 9:92187317-92187339 GCCCTTTTATTTTACACAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057083064 Original CRISPR TCAAGGACTTTCCTGGCACT AGG (reversed) Intergenic
No off target data available for this crispr