ID: 1057083071

View in Genome Browser
Species Human (GRCh38)
Location 9:92187325-92187347
Sequence ATTTTACACAAGAGGAGCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057083066_1057083071 8 Left 1057083066 9:92187294-92187316 CCTTGACAGAGTCATCAAATCCA No data
Right 1057083071 9:92187325-92187347 ATTTTACACAAGAGGAGCTCTGG No data
1057083065_1057083071 18 Left 1057083065 9:92187284-92187306 CCAGGAAAGTCCTTGACAGAGTC No data
Right 1057083071 9:92187325-92187347 ATTTTACACAAGAGGAGCTCTGG No data
1057083064_1057083071 25 Left 1057083064 9:92187277-92187299 CCTAGTGCCAGGAAAGTCCTTGA No data
Right 1057083071 9:92187325-92187347 ATTTTACACAAGAGGAGCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057083071 Original CRISPR ATTTTACACAAGAGGAGCTC TGG Intergenic
No off target data available for this crispr