ID: 1057083775

View in Genome Browser
Species Human (GRCh38)
Location 9:92190437-92190459
Sequence GTAGATGGACAGCTGCCTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057083775_1057083778 -10 Left 1057083775 9:92190437-92190459 CCCATAGGCAGCTGTCCATCTAC No data
Right 1057083778 9:92190450-92190472 GTCCATCTACAGTGTCTGGCAGG No data
1057083775_1057083780 0 Left 1057083775 9:92190437-92190459 CCCATAGGCAGCTGTCCATCTAC No data
Right 1057083780 9:92190460-92190482 AGTGTCTGGCAGGTTTTTGCTGG No data
1057083775_1057083781 27 Left 1057083775 9:92190437-92190459 CCCATAGGCAGCTGTCCATCTAC No data
Right 1057083781 9:92190487-92190509 CAGCTGAGCTAGTGCCAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057083775 Original CRISPR GTAGATGGACAGCTGCCTAT GGG (reversed) Intergenic
No off target data available for this crispr