ID: 1057085643

View in Genome Browser
Species Human (GRCh38)
Location 9:92207388-92207410
Sequence CTGCTTCTAGAGCTGGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057085643_1057085654 22 Left 1057085643 9:92207388-92207410 CCCAGCTCCAGCTCTAGAAGCAG No data
Right 1057085654 9:92207433-92207455 TAGTTCCCTTCATGGGAGAATGG No data
1057085643_1057085647 -6 Left 1057085643 9:92207388-92207410 CCCAGCTCCAGCTCTAGAAGCAG No data
Right 1057085647 9:92207405-92207427 AAGCAGCCATTTTTTTCCCAGGG No data
1057085643_1057085657 29 Left 1057085643 9:92207388-92207410 CCCAGCTCCAGCTCTAGAAGCAG No data
Right 1057085657 9:92207440-92207462 CTTCATGGGAGAATGGTTTTAGG No data
1057085643_1057085651 14 Left 1057085643 9:92207388-92207410 CCCAGCTCCAGCTCTAGAAGCAG No data
Right 1057085651 9:92207425-92207447 GGGAAACCTAGTTCCCTTCATGG No data
1057085643_1057085646 -7 Left 1057085643 9:92207388-92207410 CCCAGCTCCAGCTCTAGAAGCAG No data
Right 1057085646 9:92207404-92207426 GAAGCAGCCATTTTTTTCCCAGG No data
1057085643_1057085652 15 Left 1057085643 9:92207388-92207410 CCCAGCTCCAGCTCTAGAAGCAG No data
Right 1057085652 9:92207426-92207448 GGAAACCTAGTTCCCTTCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057085643 Original CRISPR CTGCTTCTAGAGCTGGAGCT GGG (reversed) Intergenic
No off target data available for this crispr