ID: 1057091109

View in Genome Browser
Species Human (GRCh38)
Location 9:92258774-92258796
Sequence CAGAGCTCCACCTCACAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 0, 2: 4, 3: 10, 4: 202}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057091104_1057091109 21 Left 1057091104 9:92258730-92258752 CCCCAGCATCAGGCAGCAGAGAA 0: 1
1: 0
2: 2
3: 57
4: 464
Right 1057091109 9:92258774-92258796 CAGAGCTCCACCTCACAGCTTGG 0: 1
1: 0
2: 4
3: 10
4: 202
1057091108_1057091109 -9 Left 1057091108 9:92258760-92258782 CCTAAAGTCTCACACAGAGCTCC 0: 1
1: 0
2: 0
3: 13
4: 217
Right 1057091109 9:92258774-92258796 CAGAGCTCCACCTCACAGCTTGG 0: 1
1: 0
2: 4
3: 10
4: 202
1057091105_1057091109 20 Left 1057091105 9:92258731-92258753 CCCAGCATCAGGCAGCAGAGAAC 0: 1
1: 0
2: 3
3: 24
4: 337
Right 1057091109 9:92258774-92258796 CAGAGCTCCACCTCACAGCTTGG 0: 1
1: 0
2: 4
3: 10
4: 202
1057091106_1057091109 19 Left 1057091106 9:92258732-92258754 CCAGCATCAGGCAGCAGAGAACA 0: 1
1: 0
2: 2
3: 26
4: 307
Right 1057091109 9:92258774-92258796 CAGAGCTCCACCTCACAGCTTGG 0: 1
1: 0
2: 4
3: 10
4: 202
1057091107_1057091109 -8 Left 1057091107 9:92258759-92258781 CCCTAAAGTCTCACACAGAGCTC 0: 1
1: 0
2: 0
3: 5
4: 149
Right 1057091109 9:92258774-92258796 CAGAGCTCCACCTCACAGCTTGG 0: 1
1: 0
2: 4
3: 10
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057091109 Original CRISPR CAGAGCTCCACCTCACAGCT TGG Intronic
901653163 1:10754666-10754688 CAGACCTCCTCCCCGCAGCTGGG + Intronic
902863055 1:19259636-19259658 CACAGCTCCACACCAGAGCTGGG + Exonic
902878180 1:19353393-19353415 CTGACCCCCACCTCACATCTTGG + Intronic
903544009 1:24112303-24112325 CACTGCTCCTCCTCTCAGCTGGG + Intergenic
904894065 1:33800860-33800882 CACAGCCCCTCCTCACATCTGGG - Intronic
905875321 1:41428395-41428417 CAGATCTCCACCGCTCAGCCTGG - Intergenic
906478238 1:46184186-46184208 CAGGGCTGCACCACACAGCTGGG - Exonic
907463457 1:54619989-54620011 CAGGCCTCCAGCTCACAGCCTGG + Exonic
907464289 1:54624681-54624703 CAGGGCTCCATCTCCCAGCCTGG - Intronic
909713942 1:78684279-78684301 CAGAATTCCACCAGACAGCTGGG + Intergenic
912372821 1:109186942-109186964 CAGTGCTCCTCCTCTGAGCTGGG - Intronic
915633888 1:157173245-157173267 CAGGGCTCCAGCTCAGGGCTGGG - Intergenic
915658239 1:157379850-157379872 CAGGGCTCCAGCTCAGGGCTGGG - Intergenic
915670776 1:157486839-157486861 CAGGGCTCCAGCTCAGGGCTGGG + Intergenic
917123515 1:171665188-171665210 CAGAGCTGTGACTCACAGCTAGG - Intergenic
918885140 1:190183524-190183546 CAGAGCTTCTCATTACAGCTGGG + Intronic
919640284 1:200039470-200039492 CTGACCTCCTCCTCGCAGCTTGG + Intronic
920105595 1:203551011-203551033 CACTGCTCCTCCTCACATCTTGG + Intergenic
922206726 1:223454728-223454750 CTGATCCCCACCTCACACCTAGG - Intergenic
1067351940 10:45484375-45484397 CAGACCTTCACCTCACCGCAGGG - Intronic
1069779373 10:70945174-70945196 CAGTCCTCCACTTCACAGATGGG - Intergenic
1070289373 10:75104659-75104681 CAGAGCTCCATGCCACAGCTTGG + Intronic
1072628006 10:97126635-97126657 ATAAGCTCCACCTTACAGCTGGG + Intronic
1075200270 10:120396506-120396528 CCGAGACCCACTTCACAGCTGGG + Intergenic
1075404368 10:122184542-122184564 CAGAGCTCAGCCACACTGCTGGG - Intronic
1075741277 10:124697939-124697961 CTCAGCTGCACCTCTCAGCTGGG - Intronic
1076205479 10:128597073-128597095 GTGTGCTCTACCTCACAGCTGGG + Intergenic
1076717075 10:132371606-132371628 TAGAGCCCCACGTCTCAGCTGGG + Intronic
1076921043 10:133454777-133454799 CAGACTTCCACCCCACCGCTGGG - Intergenic
1078067517 11:8088106-8088128 CACAGCCCCAGATCACAGCTGGG + Intronic
1079495817 11:21042788-21042810 CAGAGCTGGAACACACAGCTTGG - Intronic
1082972465 11:59037854-59037876 AAGATCTCCTCCTCACAGTTTGG + Intronic
1083327377 11:61879647-61879669 CAGTGCTCCAGCTCACACCCCGG - Intronic
1084088450 11:66865464-66865486 CAGGGCTCCTGCCCACAGCTGGG + Intronic
1087107385 11:94423802-94423824 CAGGGCTACAGCACACAGCTGGG + Intronic
1087166809 11:95012830-95012852 CAGAGCTGCACCTCAGAATTTGG + Intergenic
1088074935 11:105836443-105836465 TAGAGCTCCACCTATCAGGTAGG - Intronic
1089060037 11:115618890-115618912 TGGAGCTACACCTCAAAGCTGGG + Intergenic
1090417165 11:126548483-126548505 TTGAACACCACCTCACAGCTAGG - Intronic
1091337925 11:134786314-134786336 CTGTGCTCCTCCTCACAGCATGG + Intergenic
1092640185 12:10498240-10498262 CAGAGTTCCAGCACAAAGCTAGG - Intergenic
1092995378 12:13944874-13944896 CATAGCTCTCCCTCTCAGCTGGG - Intronic
1099053409 12:77808688-77808710 CAGAGCTCCAGCACTCTGCTGGG + Intergenic
1101708108 12:107239845-107239867 CAGAGCCACACCTCACTGCATGG + Intergenic
1102087928 12:110159233-110159255 CTGAGCTCAACCACACATCTTGG - Intronic
1102396998 12:112594725-112594747 AAGAGCTCCAGCTCACACATTGG - Intronic
1102482599 12:113233923-113233945 CAGAGCTCTACCTCACGGAGGGG - Intronic
1103529480 12:121590767-121590789 CAGACCCCCAGTTCACAGCTGGG + Intergenic
1104082557 12:125443228-125443250 CAGTCCTCCACCTCACACCTGGG - Intronic
1111028462 13:82566090-82566112 TAGAACTCCGACTCACAGCTGGG - Intergenic
1113231349 13:108217031-108217053 GAGAGCTCCAGGTCAAAGCTGGG - Intronic
1114366416 14:22032166-22032188 CAGAGGAGCACCTTACAGCTCGG + Intergenic
1115279476 14:31645359-31645381 TAGAAATGCACCTCACAGCTGGG - Intronic
1118255502 14:64201776-64201798 CAGAACTGCACCCCATAGCTGGG - Intronic
1118919924 14:70140540-70140562 CCTTGCTCCACCTCACACCTTGG + Intronic
1122024739 14:98867584-98867606 CCCAGCTCCAACACACAGCTTGG + Intergenic
1122160612 14:99781484-99781506 CAGTTCCCCACCCCACAGCTGGG + Intronic
1122555183 14:102575064-102575086 CAGAGCTCCAGAACACAGCACGG - Intergenic
1122889876 14:104727322-104727344 CACACCCCCACCTCACACCTCGG + Intronic
1125595724 15:40884802-40884824 CAGAGCACTGCCTCAGAGCTGGG - Intergenic
1127349495 15:58136303-58136325 CCCCTCTCCACCTCACAGCTCGG + Intronic
1127954018 15:63836647-63836669 CACAGCACCACACCACAGCTGGG + Intergenic
1128214524 15:65924997-65925019 CAAAGCTCCACCTCAGTGCAAGG - Intronic
1128649268 15:69398592-69398614 CTGAGCTCCACCCAGCAGCTGGG + Intronic
1130902620 15:88218592-88218614 CAGGGCTCCAGCTGACAGCATGG - Intronic
1131511504 15:93051765-93051787 CATAGCTCCACTTCACAAATGGG - Intronic
1133287237 16:4696294-4696316 CCCAGCTCCATCTCAGAGCTCGG + Intergenic
1133476891 16:6132269-6132291 CAGAGCTCCACCTAACTGCCAGG - Intronic
1133478902 16:6150411-6150433 TAGAGCTCCACTTCTCACCTGGG - Intronic
1135854367 16:25993228-25993250 CTGTGCTCCACCCCAGAGCTGGG + Intronic
1137482630 16:48865228-48865250 CAGAGCTGTCCCTCAGAGCTGGG + Intergenic
1137693615 16:50446766-50446788 AAGAGCCCAAACTCACAGCTTGG + Intergenic
1137701266 16:50499665-50499687 CATGGTTCCACCTCACAGCAAGG + Intergenic
1137704777 16:50526951-50526973 CAGAGCACCACCTGTCAGCAGGG - Intergenic
1138348239 16:56332850-56332872 CAGAGGGCGTCCTCACAGCTTGG + Intronic
1138680030 16:58677699-58677721 CAGAGCTCCAAAGCACACCTGGG + Intronic
1139876836 16:70152936-70152958 GAGAGCTGGGCCTCACAGCTTGG + Intronic
1141483119 16:84319806-84319828 CAGCTCTGCACCTCCCAGCTGGG + Intronic
1141674952 16:85512975-85512997 CAGAGCTCCCCATGGCAGCTGGG - Intergenic
1141686538 16:85573563-85573585 CACAGCTCCACTTCACAGCTGGG - Intergenic
1142868900 17:2808041-2808063 CAGGCCTCCATCTCACAGGTTGG - Intronic
1144385870 17:14748664-14748686 CAGAACTCCATCCCACTGCTTGG - Intergenic
1144725071 17:17497715-17497737 CAGACCACCACCTGACAGCTGGG - Intergenic
1147982401 17:44282595-44282617 CAGAGCTCAACCTTCCTGCTGGG - Intergenic
1150567319 17:66353099-66353121 CAGAGATCTACTACACAGCTGGG + Intronic
1151341135 17:73471705-73471727 CTGTGGTCCACCTCACACCTGGG - Intronic
1151418449 17:73982047-73982069 CAGAGCTCCGTCTCACAAGTGGG - Intergenic
1151453062 17:74211181-74211203 CAGAGGCCCACCTGAGAGCTTGG - Intergenic
1152632296 17:81415678-81415700 GAGAGCTCCACCTCCCACCGAGG - Intronic
1155292063 18:24352188-24352210 CTGACCTCAGCCTCACAGCTAGG - Intronic
1157863950 18:51165167-51165189 CAGAGCTCCGCCTGCCTGCTTGG + Intergenic
1160315419 18:77840086-77840108 CAGAGCCCCATGTTACAGCTGGG + Intergenic
1161310580 19:3591831-3591853 CCCAGCTCCAGCACACAGCTTGG + Exonic
1161389499 19:4013852-4013874 AAGGGCTCCAGCTCCCAGCTTGG - Intronic
1162043152 19:7982416-7982438 CAGAGATCCTCCTGGCAGCTGGG + Intronic
1162414111 19:10524160-10524182 CAGAGCTCCACATCTCGGCCTGG + Intergenic
1162657403 19:12141252-12141274 CAGAACTCCACTTCACTCCTTGG + Intronic
1162738400 19:12759466-12759488 CCCATCTCCACCTCCCAGCTGGG - Intergenic
1165773177 19:38389905-38389927 CAGTGCTCCCCCTCACAGCTGGG - Intronic
1166231447 19:41427518-41427540 CAGAGCCCCATCTCTCAGGTCGG - Exonic
925003214 2:422650-422672 CACAGCTGCACCTCACAGCGAGG + Intergenic
925147973 2:1593739-1593761 CAGGGCTCTTCCTCACAGCAAGG - Intergenic
926320030 2:11743267-11743289 CAGAGGCCCACTTCACAGTTAGG - Intronic
926947032 2:18199700-18199722 CAGTGCTCCAGTTCACAGGTTGG + Intronic
927267121 2:21163226-21163248 CAGGGGTCCACCCCACATCTGGG - Intergenic
928396314 2:30945554-30945576 CAGAGCTCCAGCTCTAAGATAGG - Intronic
929634606 2:43504988-43505010 CATAGCTCCACTTCACCACTAGG - Intronic
932199067 2:69809872-69809894 CCCAGCCCCACCTCAAAGCTGGG + Intronic
932592814 2:73077239-73077261 CAGAGGTGCTCCTCACTGCTAGG - Intronic
933810702 2:86031234-86031256 CTGAGCTCCCCTGCACAGCTGGG - Intronic
935315370 2:101828360-101828382 CAAAGCACCTCCTCTCAGCTTGG - Intronic
937882663 2:126880311-126880333 CAGAGCCCCACCTTTCATCTGGG - Intergenic
945029261 2:205648562-205648584 CAGAGCTGCTCCTCAAATCTGGG - Intergenic
947979474 2:234396832-234396854 CAGAGCTCCAGCTCACTGCACGG + Intergenic
948709083 2:239814165-239814187 CAGAGCACTGCCTCACAGCGAGG - Intergenic
1168733041 20:103796-103818 CAGGGCTGCAGCACACAGCTTGG + Intergenic
1168952337 20:1810982-1811004 CAGAGCTCCAGCTCTCAGCCCGG - Intergenic
1169487211 20:6043573-6043595 CTGAGCCCCACCTCACAGCTGGG + Intronic
1171520439 20:25771163-25771185 CCGATATCCACCTCAGAGCTGGG - Intronic
1171556480 20:26085330-26085352 CCGATATCCACCTCAGAGCTGGG + Intergenic
1173310190 20:41890404-41890426 CTGAGCTCCACTTCACCGATGGG - Intergenic
1174720979 20:52812301-52812323 CAGAGCTTGGCCCCACAGCTCGG + Intergenic
1175070119 20:56325876-56325898 CAGAGTTTCACCTCAGACCTTGG - Intergenic
1175936920 20:62518222-62518244 GAGAGCTACCCCTCCCAGCTCGG + Intergenic
1176135161 20:63519357-63519379 CCGAGCTCCCCCTCCCAGGTGGG + Intergenic
1179437118 21:41369637-41369659 CAGAGCAGCACCTCACTTCTCGG - Intronic
1179476389 21:41648846-41648868 TTGAGCTCCCACTCACAGCTAGG - Intergenic
1179516372 21:41910505-41910527 CATCTTTCCACCTCACAGCTTGG - Intronic
1179966591 21:44810381-44810403 CACAGCTCTGCCTCACAGGTTGG - Intronic
1180796605 22:18608849-18608871 GTGAGCTGCCCCTCACAGCTGGG - Exonic
1180874167 22:19167029-19167051 CAGTTCTCCACCTGACACCTTGG + Intergenic
1181225119 22:21386422-21386444 GTGAGCTGCCCCTCACAGCTGGG + Exonic
1181253513 22:21548391-21548413 GTGAGCTGCCCCTCACAGCTGGG - Exonic
1181597656 22:23927086-23927108 CAGAATTCCAGCTCACAGATTGG + Intergenic
1182475812 22:30575675-30575697 TAGGGCTCCCCCTCTCAGCTGGG - Intergenic
1182584629 22:31337336-31337358 CTGAGCACCAACTCACAGCCAGG + Intronic
1182771570 22:32800688-32800710 CAGAGCTCCACCCTTCAGCAAGG - Intronic
1183398483 22:37587093-37587115 CAGAGCTTCCCCTCCCACCTGGG - Intergenic
1185203223 22:49521266-49521288 CACAGCTCCTCCTCACAGAAGGG + Intronic
952530853 3:34260336-34260358 CAGTACTCCATCTCAGAGCTAGG + Intergenic
952885625 3:38009635-38009657 CACAGCTCCCCCTCAAACCTTGG + Exonic
953180347 3:40589042-40589064 CTGGGCTTCTCCTCACAGCTTGG + Intergenic
953605266 3:44409669-44409691 CTGAGCTCCAGCTCAGGGCTAGG + Intergenic
954305007 3:49721020-49721042 CAGAGGTCCTCCTCACTGGTGGG - Exonic
955168535 3:56539995-56540017 AAGAACTACACATCACAGCTTGG - Intergenic
955779813 3:62472560-62472582 CAGAGGGCCACCTGGCAGCTTGG + Intronic
956013614 3:64857977-64857999 CAAATCTCCACCTCAGAGCCAGG + Intergenic
956219725 3:66889385-66889407 CAGAGCTAGAGGTCACAGCTAGG + Intergenic
958499579 3:94888124-94888146 TAGACCTGCACATCACAGCTGGG + Intergenic
958853249 3:99354237-99354259 AAGAACTCCACTTCACGGCTAGG + Intergenic
960619920 3:119627738-119627760 CAGAGCTGCACCACCCAGCTAGG - Intronic
962411323 3:135143867-135143889 CACAGCTCCTCCTCCCTGCTGGG - Intronic
965236080 3:166125303-166125325 CACAGCACCACCTTACTGCTGGG + Intergenic
967939557 3:194755703-194755725 CAGGCCTCCAGCTCACAGCCTGG - Intergenic
968142266 3:196267968-196267990 CAGAGATCCACCCAACAGCCTGG - Intronic
968678554 4:1899654-1899676 CAGAGCCCCAAAACACAGCTAGG - Intronic
969318661 4:6397101-6397123 CAGTGTTCAACCTCAGAGCTTGG + Intronic
969383693 4:6827393-6827415 CAGAACTCCAGCTAACAGCAAGG + Intronic
972284361 4:37634161-37634183 AAGATCTCCACCTCACATATGGG + Intronic
974369179 4:60992115-60992137 CACAGCTCTCCCACACAGCTCGG - Intergenic
975735027 4:77372685-77372707 CAGAGCTACAACTCACAAGTGGG - Intronic
981100779 4:140826931-140826953 CAGACCTCCAGCTCACTGTTAGG - Intergenic
984375231 4:178921804-178921826 CAGCGCTCCACCTGCCAACTTGG - Intergenic
986096223 5:4556220-4556242 CAGAGCTCCAGGGCACATCTGGG - Intergenic
991494479 5:67214010-67214032 CAGAGCTCTACCTTTTAGCTTGG + Intergenic
993765339 5:91849324-91849346 CACAGCCCCACCTAACAGCAGGG + Intergenic
995457759 5:112369906-112369928 CAGACCTACACCTCAGAGGTGGG - Intronic
995471295 5:112504334-112504356 AAGAGCTCCAGCTGACATCTGGG + Intergenic
997240443 5:132302646-132302668 CAGAGCTTCCCCTCAGTGCTTGG + Intronic
998426285 5:142031435-142031457 GAGTGCTCCACCTTACTGCTCGG + Intergenic
1001597084 5:172905307-172905329 CAGAGTTGCACATTACAGCTGGG + Intronic
1002518197 5:179774653-179774675 CAGAGCCCTGCCTCACAGATGGG + Exonic
1004302473 6:14470926-14470948 CATAGCTCAAGCTCACAGCCAGG - Intergenic
1006437399 6:34033128-34033150 CAGAGACCCAGCTCACAGCATGG + Intronic
1012744505 6:103067899-103067921 CAGCCTTCCACCACACAGCTTGG - Intergenic
1012864451 6:104601163-104601185 CAGAGCCCCCCCACACAGTTCGG - Intergenic
1013836927 6:114343681-114343703 CTGAGCTCCGCTTCCCAGCTAGG - Intergenic
1014199290 6:118590639-118590661 CGGAGTTCCCCCTCTCAGCTTGG + Intronic
1014636583 6:123854731-123854753 CAGAGCTTCACCTTCCTGCTTGG - Intronic
1016120881 6:140339980-140340002 CAGAGCTCCAAACCAAAGCTTGG + Intergenic
1018746182 6:166764187-166764209 CTGAGCCCCAGCTCAGAGCTGGG + Intronic
1019364178 7:623232-623254 CAGAGCTCCTGCTCCCGGCTGGG + Intronic
1020469623 7:8521380-8521402 CACAGTTCCACCTAACAGCAAGG - Intronic
1021688536 7:23210863-23210885 CAGCCCTCCACCCCACAGGTGGG - Intergenic
1024049118 7:45607354-45607376 CAGATCTCCACCTACCATCTTGG - Intronic
1025280933 7:57626127-57626149 CCGATATCCACCTCAGAGCTGGG - Intergenic
1025303797 7:57839380-57839402 CCGATATCCACCTCAGAGCTGGG + Intergenic
1025997252 7:66535769-66535791 CAGAGCCCCAACTCACTGCCAGG - Intergenic
1026405068 7:70056519-70056541 CAGTGCTCGGGCTCACAGCTGGG + Intronic
1029359642 7:100079288-100079310 AACAGCTCCCTCTCACAGCTGGG + Intronic
1031483821 7:122306086-122306108 CAGAGCTGAACCCCGCAGCTAGG + Intronic
1032492386 7:132333352-132333374 GGGAGCTCCAGCTCAGAGCTGGG - Intronic
1033306488 7:140229837-140229859 GAGAGCTCCACGTCCCAGCGTGG - Intergenic
1033414566 7:141150652-141150674 GAGAGGTCCAGCTGACAGCTGGG + Intronic
1035234048 7:157484808-157484830 GAGAGCTCCACCTTTCTGCTGGG - Intergenic
1037640697 8:20739967-20739989 AAGTGCTTCACTTCACAGCTAGG + Intergenic
1038533570 8:28338062-28338084 CAGAGCTCCTCATCATAGCGTGG - Intronic
1039471177 8:37814653-37814675 CAGAGCCCCACGTCAGAGCCAGG + Intronic
1039510826 8:38090690-38090712 GAGATCTGCACCTCCCAGCTGGG + Intergenic
1039815646 8:41092400-41092422 GAGAGTTTCACCTCACACCTTGG + Intergenic
1042871014 8:73399478-73399500 AAGAGCTCCCCCACTCAGCTGGG - Intergenic
1043299250 8:78705962-78705984 CAGAGCAGGACCTCACAACTGGG - Intronic
1046285796 8:112091999-112092021 CAGAGCTGCAGTGCACAGCTTGG - Intergenic
1047173384 8:122516652-122516674 CAGGGCACCACCTCACAGCTTGG + Intergenic
1049806760 8:144544546-144544568 CAGCTCTCCACCTCACATCATGG - Intronic
1055051891 9:71989648-71989670 CAGAGCTCCCTCGCATAGCTAGG - Intergenic
1056902632 9:90613835-90613857 GAGAGCTCCAACTCTCAGCCAGG + Exonic
1057091109 9:92258774-92258796 CAGAGCTCCACCTCACAGCTTGG + Intronic
1060470785 9:123946508-123946530 CAGAGTTCAGACTCACAGCTAGG + Intergenic
1061291824 9:129654859-129654881 CACAGCTCCACCGCACCGCAGGG + Intergenic
1061545848 9:131303874-131303896 CAGGGCTGGAGCTCACAGCTGGG + Intronic
1189649892 X:43177573-43177595 CAGAGCTGGACCCCTCAGCTAGG - Intergenic
1189693612 X:43641433-43641455 CACAGCTCCAGCTCTCAGCTGGG - Intergenic
1193076452 X:77360871-77360893 CAGAGCTCCACTTGAAACCTAGG - Intergenic
1194419988 X:93661336-93661358 CAGAGCTCGATCGCTCAGCTGGG - Intergenic
1195883843 X:109620042-109620064 CAGTGCTAGACCTCACAGCATGG - Intergenic
1200250937 X:154553334-154553356 CAGAGCCCCACATAACATCTCGG - Intronic