ID: 1057092998

View in Genome Browser
Species Human (GRCh38)
Location 9:92277087-92277109
Sequence ATGTAGTCTACATATCACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 114}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057092998 Original CRISPR ATGTAGTCTACATATCACCC AGG (reversed) Intronic
901562861 1:10086718-10086740 ATGTAGTCTCACTGTCACCCAGG + Intronic
901601232 1:10425058-10425080 ATGTAGTCTCACTGTCACCCAGG + Intergenic
904591289 1:31616987-31617009 ATTTAATCTTCATATCAACCTGG - Intergenic
904727478 1:32560643-32560665 ATGTAGTCTCACTCTCACCCAGG + Intronic
905079783 1:35308015-35308037 ATGGAATCTCGATATCACCCAGG + Intronic
909215318 1:72879313-72879335 ATGTAGTATCTAGATCACCCTGG - Intergenic
910007098 1:82411132-82411154 TTGTTGTTTATATATCACCCAGG + Intergenic
911583770 1:99666762-99666784 ATGTAGTCTACATCTCAAGTGGG - Intronic
914980925 1:152413778-152413800 ATTTTGCCTAAATATCACCCTGG + Intronic
918247925 1:182676296-182676318 ATGTAATCAACATACCACCTAGG + Intronic
920072947 1:203316231-203316253 CTGTAGGCTACATATGACCCAGG - Intergenic
1063023110 10:2149121-2149143 ATGGAGTCTGTCTATCACCCAGG + Intergenic
1065215263 10:23441674-23441696 ATCTACTCTACACATCAACCAGG - Exonic
1073284185 10:102377377-102377399 ATGTAGTCTCTCTGTCACCCAGG + Intronic
1073835305 10:107434577-107434599 ATATAGTCTATATATGACTCAGG - Intergenic
1079590577 11:22178091-22178113 ATGTTGTCTAGATAATACCCAGG - Intergenic
1081207336 11:40291577-40291599 ATGTGGTCTTCAGATTACCCGGG - Intronic
1081614691 11:44583775-44583797 ATGCAATCTCCATAACACCCTGG - Intronic
1086892207 11:92271194-92271216 AAGGAGTCTACATGTCACACTGG - Intergenic
1089968346 11:122672343-122672365 ATGGAGTCTCCCTGTCACCCAGG + Intronic
1091195331 11:133726093-133726115 AGGTACACTACATCTCACCCAGG + Intergenic
1093497208 12:19771920-19771942 ATTTAGTCTACATAGCCCCAAGG + Intergenic
1093969250 12:25359807-25359829 CTGTAATCTTCATATCACCTTGG - Intergenic
1095328543 12:40928283-40928305 ATGTACTATACATATCAGCTTGG + Intronic
1098698417 12:73590216-73590238 AGATAGTCTTCATTTCACCCTGG + Intergenic
1100928305 12:99575842-99575864 ATAAAGTCTACATAACAACCAGG + Intronic
1102985363 12:117273333-117273355 ATATAGGCTACATTTCACCAAGG + Intronic
1106722008 13:32444827-32444849 ATGTAGTCTACACCACACCTAGG + Intronic
1109263209 13:60167462-60167484 ATGAAGTCTACATAAAACGCAGG + Intergenic
1112670168 13:101626183-101626205 ATGAAGACTACAAATCACCTGGG - Intronic
1112777589 13:102862285-102862307 ACGAAGGCTCCATATCACCCCGG + Exonic
1115057122 14:29142250-29142272 ATTTAGTCTTCAAATCACACAGG - Intergenic
1116053671 14:39836861-39836883 ATGTTTTCTACAGCTCACCCTGG - Intergenic
1119983709 14:79111710-79111732 ATGGAGTCTCTCTATCACCCAGG - Intronic
1120920449 14:89750447-89750469 ATATACTCTACACAGCACCCTGG - Intergenic
1124790200 15:32719213-32719235 CTGTAGTCTACAAATAACTCCGG - Intronic
1125994517 15:44145079-44145101 CTGTAGTTTATATATCCCCCTGG - Intronic
1132148052 15:99440185-99440207 CTGCAGTCCCCATATCACCCGGG + Intergenic
1132790849 16:1686661-1686683 ATGGAGTCTAGCTGTCACCCAGG - Exonic
1141124765 16:81393278-81393300 ATGGAGTTAACATATGACCCAGG + Intergenic
1147400843 17:40179090-40179112 ATGTAGTCTCACTGTCACCCAGG + Intronic
1151334707 17:73433127-73433149 GTCTAGTCTTCACATCACCCTGG + Intronic
1152494146 17:80659225-80659247 ATGGAGCCTACATTTCACCCAGG - Intronic
1156190277 18:34711212-34711234 GCGTTGTTTACATATCACCCTGG + Intronic
1156324131 18:36057921-36057943 ATGGAGCTTACATATCAGCCAGG - Intronic
1161445172 19:4314431-4314453 ATGTAGTCAGCATAAAACCCGGG + Intronic
1162863474 19:13525677-13525699 ATGTAGTCTCACTCTCACCCAGG - Intronic
1163528094 19:17833409-17833431 ATGAAGACTAAATATCACACTGG + Intronic
1164227084 19:23255485-23255507 ATGGAGTCTCCCTGTCACCCAGG + Intergenic
1166604998 19:44133715-44133737 ATGTACTCAAAATATCACCACGG - Exonic
929417336 2:41756750-41756772 ACATAGTCTACATTTCATCCTGG - Intergenic
931392499 2:61856168-61856190 ATGGAGTCTCCTTGTCACCCAGG + Intergenic
932716622 2:74104937-74104959 ATGTAGTGTACAAATCAGCATGG - Exonic
935552523 2:104473222-104473244 ATAGAGTCTAAATATAACCCAGG - Intergenic
936785073 2:116085050-116085072 ATGCACTTTACTTATCACCCTGG + Intergenic
941160963 2:162033298-162033320 ATGTAGGCTCCATAACACCAGGG + Intronic
941273071 2:163454731-163454753 TAGTAGTCTACAGATCACCCAGG + Intergenic
941625210 2:167823773-167823795 ATGCTGTCAGCATATCACCCAGG + Intergenic
945526200 2:210890368-210890390 ATCAAGTCTACATAACAACCAGG + Intergenic
945541891 2:211098219-211098241 AGGTAGTATACTTATCACCCAGG - Intergenic
1169762667 20:9113399-9113421 ATGTAGACTACACATCCCGCGGG - Intronic
1174466183 20:50719331-50719353 ATGGAGTCTAACTGTCACCCAGG - Intergenic
1178590686 21:33907098-33907120 ATGTACTTTACATTTAACCCAGG + Intronic
1179510325 21:41868714-41868736 ATGGAGTCTCCCTGTCACCCAGG + Intronic
1180933164 22:19607213-19607235 ATGAAATCTACATCCCACCCAGG + Intergenic
1181569827 22:23762447-23762469 ATGGAGTCTCCCTGTCACCCAGG - Intergenic
949418757 3:3841992-3842014 ATATAGGCTACATACCACCTAGG - Intronic
950375946 3:12572607-12572629 ATGGAGTCTCCCTCTCACCCAGG + Intronic
954005180 3:47584903-47584925 ATGGAGTCTCGCTATCACCCAGG + Intergenic
959653550 3:108775283-108775305 ATATAGTCTAAATTTCAGCCCGG + Intergenic
960468642 3:118031944-118031966 ATGGAGTCTCCTTGTCACCCAGG + Intergenic
960644600 3:119865493-119865515 ATGGAGTCTTCCTGTCACCCAGG + Intronic
962249112 3:133824119-133824141 AGGTAGTGGACATACCACCCAGG + Intronic
966276342 3:178175116-178175138 ATGTTGTCTACATAGCAGTCTGG - Intergenic
967139258 3:186540050-186540072 ATGTATCCTCCATATCACCTAGG - Intronic
967263423 3:187668541-187668563 ATGTATTTTACATATCAACCTGG + Intergenic
968214651 3:196878615-196878637 ATGGAGTCTTCCTGTCACCCAGG + Intronic
971909710 4:32779873-32779895 ATATAATCTATATATCATCCTGG - Intergenic
974954006 4:68616681-68616703 ATGGAGTCTAACTGTCACCCAGG + Intronic
977316729 4:95459071-95459093 ATGTAGTGGACAAATAACCCAGG - Intronic
977637941 4:99322306-99322328 ACCAAGTCTACATATCAGCCTGG + Intergenic
984518702 4:180774511-180774533 ATGTAGTTTGCATTTCACACAGG - Intergenic
987418718 5:17692824-17692846 ATGGAGTCTAACTGTCACCCAGG + Intergenic
987661470 5:20883867-20883889 GTGTAGGCCACATATCACTCTGG + Intergenic
988762116 5:34321451-34321473 GTGTAGGCCACATATCACTCTGG - Intergenic
989150753 5:38297572-38297594 ATTTAGTCTTCATATAACCTAGG - Intronic
989372883 5:40728256-40728278 ATGGAGTCTTGATGTCACCCAGG - Intronic
991045184 5:62215029-62215051 TTGTAGTCAAGATATCATCCAGG + Intergenic
991281676 5:64921708-64921730 ATCAAGTCTACATAACACACAGG - Intronic
993038361 5:82783601-82783623 ATGTAGGCTACAAGCCACCCTGG + Intergenic
997792825 5:136777520-136777542 ATGTAGTATTCAGATCTCCCAGG - Intergenic
1000650738 5:163815297-163815319 ATGGAGTCTTGCTATCACCCAGG - Intergenic
1003535367 6:6971260-6971282 ATGATGTCTACATGTCCCCCTGG + Intergenic
1007154943 6:39733487-39733509 ATGTACTCTGTTTATCACCCTGG - Intergenic
1008270684 6:49485676-49485698 ATTTAGTCTACATATCTGCAAGG - Intronic
1009024133 6:57977555-57977577 ATGTAGATTACACATCAACCTGG + Intergenic
1009199709 6:60729088-60729110 ATGTAGATTACACATCAACCTGG + Intergenic
1010664493 6:78612668-78612690 CTGAATTCTACATATCACCCAGG + Intergenic
1015029197 6:128573823-128573845 ATATATTCTAAATAACACCCAGG + Intergenic
1023901305 7:44482015-44482037 ATGTAGTCTATAAGCCACCCAGG + Intronic
1028607623 7:92672281-92672303 CTGAAGTCTACACAACACCCAGG + Intronic
1031304125 7:120102772-120102794 ATGTATGTTACATATGACCCAGG + Intergenic
1034818293 7:154193706-154193728 AGGTGGTCTACCTGTCACCCAGG - Intronic
1036414323 8:8532970-8532992 ATGGAGTCTCGCTATCACCCAGG + Intergenic
1038259671 8:25981768-25981790 ATGGAGTCTCAATCTCACCCAGG - Intronic
1039872347 8:41557292-41557314 ATGTAGTCTCATTGTCACCCAGG + Intergenic
1040752527 8:50728119-50728141 ATGTAGTCTACCTACCTGCCAGG + Intronic
1043343854 8:79275926-79275948 ATCAAGTCTACATAACAACCAGG - Intergenic
1047377107 8:124310130-124310152 ATGGAGTCTTGATGTCACCCAGG - Intergenic
1048315758 8:133360783-133360805 ATGTAGTCTTGCTATCTCCCAGG + Intergenic
1052403093 9:28025469-28025491 ATGGAGTCTACATATAAGTCAGG - Intronic
1055263469 9:74467590-74467612 ATGTAAAGTACATATCACACTGG + Intergenic
1056741528 9:89259982-89260004 ATGGAGTCACCATATGACCCAGG + Intergenic
1057092998 9:92277087-92277109 ATGTAGTCTACATATCACCCAGG - Intronic
1058747068 9:108002110-108002132 ATATAGTCTACAACTAACCCTGG + Intergenic
1060064450 9:120491080-120491102 ATTTAGTCGTCATATGACCCAGG + Intronic
1060719430 9:125965443-125965465 ATGAAGTCTAAACTTCACCCCGG - Intronic
1186002520 X:5028950-5028972 ATGAAGTTTACATAGCATCCTGG - Intergenic
1187990299 X:24863632-24863654 ATGTCGTCTACGGGTCACCCAGG + Intronic
1190225539 X:48542047-48542069 ATGGAGTCTAACTGTCACCCAGG + Intronic
1201232987 Y:11883384-11883406 ATGTATTCTAAATTTTACCCTGG + Intergenic