ID: 1057102863

View in Genome Browser
Species Human (GRCh38)
Location 9:92379756-92379778
Sequence TTTTCTCTCTTCTGCTCTGT AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 961
Summary {0: 1, 1: 0, 2: 5, 3: 98, 4: 857}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057102863_1057102865 17 Left 1057102863 9:92379756-92379778 CCTACAGAGCAGAAGAGAGAAAA 0: 1
1: 0
2: 5
3: 98
4: 857
Right 1057102865 9:92379796-92379818 CCGAAGCCTGCATTTTTTTGTGG 0: 1
1: 0
2: 0
3: 9
4: 125
1057102863_1057102866 22 Left 1057102863 9:92379756-92379778 CCTACAGAGCAGAAGAGAGAAAA 0: 1
1: 0
2: 5
3: 98
4: 857
Right 1057102866 9:92379801-92379823 GCCTGCATTTTTTTGTGGAGTGG 0: 1
1: 1
2: 4
3: 22
4: 256

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057102863 Original CRISPR TTTTCTCTCTTCTGCTCTGT AGG (reversed) Exonic
900119541 1:1042646-1042668 TTTGGTCTCTTCTTCCCTGTCGG + Intronic
901185995 1:7373563-7373585 TCTTGGCTCCTCTGCTCTGTGGG - Intronic
902146482 1:14405205-14405227 TTCTTTCTCTTTTGCTCTGATGG + Intergenic
903504871 1:23826336-23826358 TTTTCTCTCTTTTGTTTTGTTGG + Intronic
903683469 1:25113391-25113413 TTTTCTGCGTTCTGATCTGTTGG + Intergenic
904255501 1:29251961-29251983 CTTTCTCTCTGCTGCACTGTGGG + Intronic
905039753 1:34946220-34946242 TTTTCTGTGTTATGCTCAGTTGG + Intergenic
905373967 1:37505283-37505305 ATTTCTCTCTTCTGCTTTTTTGG - Intronic
905706055 1:40059266-40059288 TTTTCTGTTTTTTTCTCTGTAGG + Intronic
905964106 1:42075757-42075779 GGTTCTCTATTCTGCTCTATTGG + Intergenic
905978367 1:42198216-42198238 TTTTCTTTCTTCTCCATTGTGGG + Intronic
906016011 1:42580295-42580317 TCTTCTCTCTCATGCTGTGTGGG + Intronic
906189920 1:43891763-43891785 TTTTATCTCATCTTTTCTGTAGG + Intronic
906343685 1:45002353-45002375 TTTTCCCTTTTCTGCGCAGTGGG + Intergenic
906551795 1:46671604-46671626 TTTTCTGGGGTCTGCTCTGTGGG + Intronic
906690693 1:47791051-47791073 TCTCCTCTCTTCTGCTCTGAGGG - Intronic
906786362 1:48619511-48619533 TTTTCCCCCTTCCGCTCTGCAGG + Intronic
907114023 1:51952863-51952885 TTCTCTCCCTTCAGCTCTGCCGG + Intronic
907408485 1:54268581-54268603 TTAGCCCTCTTCTGCTCAGTGGG - Intronic
907411331 1:54285819-54285841 TTTTCTCTCTTCTTCCGTGGGGG - Intronic
907534243 1:55134878-55134900 TTTTGTCTTTTCTGATCTTTGGG - Intronic
907563783 1:55415585-55415607 GGTTCTCTATTCTGTTCTGTTGG + Intergenic
907577147 1:55536986-55537008 TTTACTTACTTCTTCTCTGTGGG + Intergenic
907633698 1:56110662-56110684 GTTTCTCTATTCTGCTCCATTGG + Intergenic
907794601 1:57702849-57702871 GTTTCTCTATTCTGTTCTATTGG - Intronic
908043147 1:60137541-60137563 TTTGCTCTCTGCTCCTCTTTTGG + Intergenic
908430192 1:64049358-64049380 TTTTCTCTCTTTTGCTATGCTGG + Intronic
909639402 1:77855225-77855247 TGTTCTCTCTTCTGTTCCATTGG + Intronic
909824639 1:80111750-80111772 AGTTCTCTTTTCTGTTCTGTTGG + Intergenic
909845085 1:80383394-80383416 TTTTCTGGCTTCTGCTCTGGAGG - Intergenic
910337493 1:86151579-86151601 TTTTCTGTCTTATCCTCTTTAGG - Intronic
910430640 1:87156364-87156386 GTTTCTTTCTTCTGCTCTTCCGG - Intronic
910601564 1:89038288-89038310 ATTTCTCTCTTCTGTTCTACTGG - Intergenic
911280527 1:95921822-95921844 TTTTCTGGGTTCTGCTCTTTTGG - Intergenic
911287570 1:96015388-96015410 TTTTCTGTCTTCTATTCTTTTGG + Intergenic
911434022 1:97831691-97831713 TTTCCTTTCTTCTGCTGTGATGG - Intronic
911530128 1:99034421-99034443 GGATCTCTCTTTTGCTCTGTTGG - Intergenic
911739985 1:101376685-101376707 TTTTCTCCCTGGTTCTCTGTTGG + Intergenic
912107368 1:106296194-106296216 TTCTCTCTCTTCAGCTCACTAGG - Intergenic
912160887 1:106983546-106983568 TTTTCTCTGTTCTGCTCCAGGGG - Intergenic
912735682 1:112147360-112147382 TTTTGTCTCTACTGCTCAGATGG + Intergenic
912820853 1:112866623-112866645 TTTTCTCTCCTATGCCCTGATGG + Intergenic
913219366 1:116647023-116647045 TGTTCTCTCGCCTGCTCTTTAGG - Intronic
913474831 1:119227224-119227246 TTTCCTCAGTTCTGCTCTGAGGG + Intergenic
914726674 1:150333663-150333685 TTTTTTCTCGTCTTCCCTGTTGG + Intronic
915819936 1:159012064-159012086 TTTTCACTCTTCTTATCTTTTGG + Intronic
916094235 1:161334339-161334361 ATTTCTCTCTTCTGCTGTTAAGG + Intronic
917006767 1:170424093-170424115 TTCTCTCTTTTCTGCTTTATTGG + Intergenic
917123661 1:171666503-171666525 TTGCACCTCTTCTGCTCTGTTGG - Intergenic
917729759 1:177862865-177862887 TTTTCTCTCTCCTGGTCTCTGGG + Intergenic
918088973 1:181271400-181271422 TTTACCCTGTTCTGCTCTATGGG + Intergenic
918352839 1:183675411-183675433 TTTTCTCTCTTTTGGTATCTTGG + Intronic
918374334 1:183893781-183893803 CTGTCTCTCTACTGGTCTGTAGG + Intronic
918429709 1:184446639-184446661 TTTAGTCTCTTCTGATCTATAGG - Intronic
918558188 1:185830571-185830593 TTATCTCTGTTCTGCTCCATTGG + Intronic
918907146 1:190511322-190511344 TTTTCTCTCCTCTTCTTGGTGGG - Intergenic
919085224 1:192912872-192912894 TTTTCTGTCATCTGCTCAGTGGG - Intergenic
919406760 1:197194585-197194607 CTTTATCTCTCCTGGTCTGTAGG - Intronic
919514466 1:198505269-198505291 TTTTCTCCCTTCTGCTACTTTGG + Intergenic
919974830 1:202603558-202603580 CTTTCTCTCTCCACCTCTGTGGG - Intronic
920220328 1:204393618-204393640 TTTTCTTTCTTCTCCTTTTTTGG - Intergenic
920418966 1:205817472-205817494 TTTTCTATCTTTTGTTCTGTGGG + Intergenic
921409568 1:214821002-214821024 GGTTCTCTATTCTGCTCCGTTGG + Intergenic
921457128 1:215385521-215385543 GTTTCTCTATTCTGTTCTATTGG - Intergenic
921617423 1:217286113-217286135 AGTTCTCTATTCTGCTCTATTGG + Intergenic
921662882 1:217828237-217828259 GGTTCTCTATTCTGTTCTGTTGG - Intronic
921693407 1:218179368-218179390 TTTCCTCTCTGCAGCTTTGTAGG - Intergenic
921814706 1:219550257-219550279 TTTTTTCTTTTTTTCTCTGTGGG - Intergenic
921978706 1:221230777-221230799 TATGCTCTCTTGTGTTCTGTTGG + Intergenic
922347356 1:224707510-224707532 TTCTCTCTCTACTCCACTGTGGG + Intronic
922368333 1:224886649-224886671 TTCTCTCCCATCTGCTCTTTAGG + Intergenic
922406045 1:225314765-225314787 CTTACTCTCTTCTGGTTTGTAGG + Intronic
922888472 1:229040179-229040201 TGTTCTCTATTCTGTTCTGTTGG - Intergenic
923707249 1:236354007-236354029 TTTTTTCTCTTCTGCTCTTCGGG + Intronic
923909748 1:238428045-238428067 TGTTCTCTATTCTGCTCCATTGG + Intergenic
924492903 1:244557053-244557075 GATTCTCTATTCTGTTCTGTTGG + Intronic
924642026 1:245843080-245843102 TTTTCTCTCTCATGTTCTTTGGG + Intronic
1064201754 10:13290496-13290518 TTTTCTTCCTTCTGATCTGCAGG - Intronic
1064253056 10:13721624-13721646 TCTTCTCACATCTGCTCTGGGGG + Intronic
1064476057 10:15690274-15690296 TTTTTTCTCATATGCCCTGTTGG + Intronic
1064705908 10:18072366-18072388 CTCTCTCTTTTCTGTTCTGTTGG + Intergenic
1064948329 10:20817625-20817647 TTTGCCCTCTTCAGCTCTGGTGG + Exonic
1065148832 10:22800799-22800821 TTTTCTATCTTCTTCTCTCTGGG + Intergenic
1065246395 10:23762967-23762989 TTTGCTCTCTGCTTCTCTATTGG - Intronic
1065462816 10:25987020-25987042 GGTTCTCTCTTCTGTTCCGTTGG - Intronic
1066301130 10:34097582-34097604 TTTTCTTTCTTCTGCTGACTTGG - Intergenic
1066411313 10:35172224-35172246 TTTTGTCTCTGCTGCTCTACTGG + Intronic
1066534254 10:36373356-36373378 TTTTCTCTCTCTTGCTTTATGGG - Intergenic
1066619573 10:37331426-37331448 GGTTGTCTATTCTGCTCTGTTGG - Intronic
1067902305 10:50254950-50254972 TTGTCTCTCTTTTTCTCTATTGG - Intergenic
1068446627 10:57133373-57133395 TTCTCTCTCTTCTGGAGTGTGGG + Intergenic
1068603429 10:58979209-58979231 TTTCAGCTCTTCTGCTTTGTGGG + Intergenic
1068641964 10:59419012-59419034 GGTTCTCTATTCTGTTCTGTTGG - Intergenic
1069015705 10:63426835-63426857 TTTTCTATCTTTTTCTCTTTTGG - Intronic
1069405048 10:68090103-68090125 TTTTTTCAAATCTGCTCTGTAGG - Intergenic
1070478767 10:76858116-76858138 TTTTCTTTCTCCTTTTCTGTTGG - Intergenic
1071316967 10:84411095-84411117 AGTTCTCTATTCTGCTCCGTTGG + Intronic
1071329025 10:84542461-84542483 TTTTCTTTCCTTTTCTCTGTTGG + Intergenic
1071416326 10:85445044-85445066 TTTTCTCTCTTATGCTTACTTGG + Intergenic
1071467275 10:85952629-85952651 TTTTCTCTCTTTTCCTCTTGTGG - Intronic
1071834186 10:89403203-89403225 TTTTCTCTGTTCTGCCCTCTAGG - Exonic
1071905249 10:90166286-90166308 GGTTCTCTATTCTGTTCTGTTGG + Intergenic
1072567393 10:96628349-96628371 TTGTTTCTCTTTTGCTCTTTTGG + Intronic
1073801065 10:107042432-107042454 TTTTCTCTCTTATGCTAACTTGG + Intronic
1074309266 10:112308266-112308288 TTTGCTCTCCTTTGCCCTGTGGG + Intergenic
1074465124 10:113674660-113674682 TTCTCTCTTTTCTTCTTTGTTGG - Intergenic
1074962521 10:118460717-118460739 TTTTTTCTCTTGTGTTCTATTGG - Intergenic
1075140183 10:119826609-119826631 TTTTTTCTCTTCTAATTTGTAGG + Exonic
1075632025 10:124006245-124006267 TTCTGTCTCTGCTGCTCTGCAGG + Intergenic
1075740669 10:124694160-124694182 CTGTCTTCCTTCTGCTCTGTGGG - Intronic
1076115849 10:127899293-127899315 TTTCTTTTCTTCTGCTATGTTGG + Intergenic
1076237300 10:128874280-128874302 TTTTCTCTATTATTCTTTGTTGG + Intergenic
1076563852 10:131385400-131385422 TTTTCTCTCTGCTCCTCCTTTGG - Intergenic
1076587069 10:131556483-131556505 TTTTCTCTCTCCTGCAGTGTTGG - Intergenic
1076930693 10:133529840-133529862 TTTTCCTTCTTCTGCATTGTGGG + Intronic
1078722352 11:13896828-13896850 TTTTCTCTGCCCTGCTCTCTGGG + Intergenic
1078928320 11:15893903-15893925 CTTTCTCTCTACACCTCTGTGGG - Intergenic
1079392241 11:20032590-20032612 TTTTCTTGCATCTGCTCTTTGGG - Intronic
1079465817 11:20729806-20729828 TATGCTCTCTTCTGCTGTGGCGG + Intronic
1080039404 11:27743639-27743661 TTTTCACTCTTCTGCTGTAAAGG + Intergenic
1080313704 11:30924681-30924703 ATTTCTATCTCCTGCTCTGAAGG - Intronic
1080646134 11:34189270-34189292 TTTTCTCTTTTCTTTTCTTTTGG - Intronic
1080732474 11:34973068-34973090 GTTTCTCCTTTCAGCTCTGTCGG + Intronic
1081025156 11:38003361-38003383 TTATCTCTCTTTTTCTCAGTGGG - Intergenic
1081107700 11:39091944-39091966 TTTTCTCTATTTGGCTCTGTAGG + Intergenic
1081130189 11:39370292-39370314 TTTTCTCTTTTCTTTTTTGTAGG + Intergenic
1081330940 11:41799050-41799072 GTTTCTCTCTTCTATTCGGTTGG - Intergenic
1081429815 11:42964359-42964381 GGTTCTCTGTTCTGTTCTGTTGG - Intergenic
1081757363 11:45554226-45554248 TTTTCTTTCTGCTGCTCTCTAGG - Intergenic
1082022587 11:47547314-47547336 TTTGCTATCTTCTCCTCTCTTGG - Intronic
1082618168 11:55388231-55388253 TTTTAACTCTTCTTCTGTGTAGG + Intergenic
1082773620 11:57228824-57228846 TCTCATCTCTTCTGCTCTCTGGG - Intergenic
1083563526 11:63693731-63693753 TTTTATTTCTTCTGGACTGTAGG + Intronic
1084073570 11:66754356-66754378 TTTTATCTCTTCTACTTTCTAGG + Intronic
1084177738 11:67432219-67432241 CTTTCTCTGTTCTGTTCTGTTGG + Intronic
1084743545 11:71154444-71154466 CTTTCTCTCTTCTGCCCGGCTGG - Intronic
1085366313 11:75948806-75948828 TTATCTTTCTTCTTCTCTGATGG - Intronic
1086139225 11:83475809-83475831 TTTTCTATTTTCTGCTCAGGAGG + Intronic
1086248947 11:84790917-84790939 TGTTCTCTATTCTGTTCTATTGG + Intronic
1086585375 11:88445328-88445350 TTTTCACCATTCTCCTCTGTAGG - Intergenic
1086616975 11:88832774-88832796 GGTTCTCTATTCTGTTCTGTTGG - Intronic
1086916348 11:92534034-92534056 ATTACTTTCTTCTGTTCTGTGGG + Intronic
1086996241 11:93359671-93359693 CTGTCTCTCTTCTGGTCTTTTGG - Intronic
1087351113 11:97033746-97033768 TTTTCTCTTTTCTGGCCTGAAGG + Intergenic
1087859140 11:103132034-103132056 TTTTCTCTCTTCTTCCTTTTAGG + Intronic
1088670756 11:112138026-112138048 TTTTCTCACTCCTGCTCGCTGGG + Intronic
1088765078 11:112967342-112967364 CTTTTTATCATCTGCTCTGTGGG + Intronic
1088787191 11:113192894-113192916 TTTTCCATCTTCTACTATGTTGG - Intronic
1088978535 11:114839297-114839319 TTTACTCTCTGCTGCTTTTTGGG + Intergenic
1089173228 11:116530155-116530177 GGTTCTCTCTTCTGTTCTATTGG - Intergenic
1089948694 11:122505529-122505551 TTTTGTATCTTCTGATCTCTAGG + Intergenic
1090200243 11:124849013-124849035 TTTTCTCTCTCTTTCTCTGTAGG - Intergenic
1090379805 11:126318489-126318511 CTTTCTCTTTCCTCCTCTGTGGG - Intronic
1090784138 11:130033465-130033487 TTTTATTTCTTAAGCTCTGTGGG - Intergenic
1091107956 11:132940652-132940674 TTTTCACTCTTTTGCTGTATTGG - Intronic
1091270250 11:134305927-134305949 TTGTCTCTTTTCTGTTTTGTGGG - Intronic
1091855623 12:3737141-3737163 CTTTCTCTCATCTTCTGTGTTGG - Intronic
1091992710 12:4969215-4969237 TTGTCACTCTTCTCCTGTGTAGG + Intergenic
1092229880 12:6770404-6770426 TTTTCTGTCTTCTGCCGTTTGGG - Exonic
1092398725 12:8153079-8153101 CTCACTCTCTTCTGCTTTGTAGG + Intronic
1092687377 12:11065397-11065419 TTTTCTCTCTTCTAATCTTCTGG + Intronic
1092986233 12:13848767-13848789 ATTCCACTCTTGTGCTCTGTTGG - Intronic
1093126530 12:15336318-15336340 TTTTCACTCTTCTGCAATTTAGG + Intronic
1093382881 12:18516569-18516591 TTTTCTCTCTCCTCCTTTTTGGG + Intronic
1093748811 12:22774737-22774759 TTTTCTTTCTTTTCCTCAGTAGG + Intergenic
1094097816 12:26727835-26727857 TTTTCTCCTTTCTTCTCCGTGGG - Intronic
1094460350 12:30691210-30691232 TCTTCTCTGTTTTGCTCTGTTGG - Intronic
1094646903 12:32334066-32334088 TTTTGTCACCTGTGCTCTGTGGG - Intronic
1095236596 12:39803779-39803801 TTATCTCTCTTCTGTCCTTTTGG - Intronic
1095360980 12:41338774-41338796 TTTTCTCACTTGTGATCGGTTGG - Intronic
1095438365 12:42216501-42216523 ATTTCTTTCTTCTTCTTTGTGGG + Intronic
1095651099 12:44610222-44610244 TTTGCTCTCTTGTGAGCTGTCGG - Intronic
1096038747 12:48495530-48495552 TTTTCACTCTCCTGCTCCATAGG + Intronic
1096880678 12:54666466-54666488 TTTTCTCTCATCTTCTCTCATGG - Intergenic
1097470541 12:59985635-59985657 ATTTCTCTATTCTGTTCTATTGG - Intergenic
1098004303 12:65979299-65979321 TTTTCTCTCTTCTACTTTTTTGG + Intergenic
1098768048 12:74514763-74514785 TTTTGTCCCTGCTGTTCTGTGGG + Intergenic
1099157553 12:79197535-79197557 TTTTCTCTTTTCTACTGTTTTGG - Intronic
1099696446 12:86027478-86027500 TTTTTTCTATTCTGTTCTCTGGG - Intronic
1100032649 12:90211500-90211522 TTTCCTCTTTTCTACTTTGTCGG + Intergenic
1100087877 12:90933931-90933953 TTTCCTTTCTTCTGCTGGGTTGG + Intronic
1100116631 12:91313474-91313496 TTCTCTCTCATTTCCTCTGTTGG - Intergenic
1100459131 12:94781127-94781149 CTTTCTCTCTTTTGCTTTGTAGG - Intergenic
1100815410 12:98382350-98382372 AGTTCTCTATTCTGTTCTGTTGG - Intergenic
1101113877 12:101512805-101512827 GGTTCTCTATTCTGCTCTATTGG + Intergenic
1101557447 12:105823570-105823592 TTCTCTCTCTTTTGCTCTTGTGG - Intergenic
1101749531 12:107571944-107571966 TCTTATCTCTTATTCTCTGTAGG - Intronic
1101862901 12:108497571-108497593 GTTTCTCTCTTTTACTCAGTTGG + Intergenic
1102201688 12:111061766-111061788 TTTTCTTTTTTCTGCTGTGATGG + Intronic
1102436973 12:112931803-112931825 TTTTCTCACTGATGCTCTCTGGG + Intronic
1103838466 12:123843453-123843475 TTGTCTCTCTCCTGATGTGTAGG + Intronic
1103984390 12:124757773-124757795 TTCTCTCTCTTCTGAGCTGTGGG - Intergenic
1104332941 12:127864683-127864705 GGTTCTCTATTCTGTTCTGTTGG - Intergenic
1104442418 12:128804859-128804881 TGTACTCTCTTTTTCTCTGTAGG - Intronic
1104711751 12:130992268-130992290 TTTTCTCTCTTCTGTCAGGTTGG - Exonic
1105228454 13:18462130-18462152 GTCTTTCTCTTTTGCTCTGTTGG - Intergenic
1105298550 13:19112748-19112770 TTTTTTTTCTTCTACTCAGTTGG - Intergenic
1105583610 13:21723752-21723774 TTTTTTTTCTTCTGCTGAGTTGG + Intergenic
1105963178 13:25361067-25361089 TTCTGTCTATTCTGCTCTATTGG + Intergenic
1106160174 13:27194458-27194480 CTTTCTCCCTCCTGCTCTGTCGG + Intergenic
1106715698 13:32385600-32385622 TTTTCTCTGTTCTGCCCTCTAGG - Intronic
1107233565 13:38140507-38140529 TGTTCTCTATTCTGCTCCATTGG + Intergenic
1107754505 13:43605468-43605490 GGTTCTCTATTCTGTTCTGTTGG - Intronic
1107821390 13:44288829-44288851 CTTTCTATATTCTGCTCTGCTGG - Intergenic
1107863216 13:44680943-44680965 ATTTCTCCTCTCTGCTCTGTGGG - Intergenic
1107977818 13:45706607-45706629 TTGTCTCTTTTCTGGTCTCTAGG - Intronic
1108177449 13:47807753-47807775 GTCTCTCTCATCTGCTCTCTAGG - Intergenic
1108486055 13:50926342-50926364 TTCTTTCTCTTTTGCTCTTTTGG + Intronic
1109500380 13:63228911-63228933 TTTCCTCTCTTCTGCTTTTTTGG + Intergenic
1109531902 13:63660511-63660533 ATTTCTCTTTTCAGCTCTATTGG + Intergenic
1110033620 13:70651438-70651460 TTTTCTTTCTACTCCTCTGATGG + Intergenic
1110131032 13:72011129-72011151 GGTTCTCTCTTCTGCTCCATTGG - Intergenic
1110162867 13:72400337-72400359 CTTTCTCTCTTCCCCTCTCTGGG + Intergenic
1110179263 13:72595640-72595662 TTCTCTCTCCTCAGCTCTGTTGG - Intergenic
1110789200 13:79568767-79568789 TCTTATTTCTTCTGCTCTCTGGG + Intergenic
1110793271 13:79608605-79608627 TGTTCTCTATTCTATTCTGTTGG + Intergenic
1110939250 13:81328829-81328851 AGTTCTCTGTTCTGCTCTATTGG - Intergenic
1111022381 13:82468961-82468983 TTTTCTCTATTCTGTTCCATTGG + Intergenic
1111123473 13:83882311-83882333 TTCTCTTTCTTCTGCTCTTTCGG + Exonic
1111680909 13:91440185-91440207 TTTTCTCTCTTCTTGCCTCTGGG + Intronic
1111748045 13:92294580-92294602 TTTTCTCTCTTTTTCTTTCTTGG + Intronic
1111814428 13:93132811-93132833 ATTTCTCTGTTCTATTCTGTTGG - Intergenic
1112074686 13:95898717-95898739 TTTGCTCTCTCCTGCCATGTAGG + Intronic
1112588210 13:100738497-100738519 TTTTCTATCTTTTCCTCTTTAGG + Intergenic
1112681273 13:101767754-101767776 TTATCTCTCTGCTACCCTGTTGG + Intronic
1112836764 13:103524343-103524365 ATTTCTTTCTTCTTCTCTGGAGG - Intergenic
1113137232 13:107105102-107105124 ATTTCTCTATTCTGTTCCGTTGG + Intergenic
1113546949 13:111160182-111160204 AGCTCTCTATTCTGCTCTGTTGG + Intronic
1113658487 13:112086737-112086759 CTTTCTCTCTCTTGCTCTTTTGG + Intergenic
1114030394 14:18573475-18573497 GGTTCTCTCTTCTGTTCTATTGG + Intergenic
1114033785 14:18601462-18601484 TTTTATTTCTTCTTCTCTTTGGG + Exonic
1114078577 14:19180637-19180659 TTTTATTTCTTCTTCTCTTTGGG + Intergenic
1114124862 14:19713549-19713571 TTTTATTTCTTCTTCTCTTTGGG - Intergenic
1114698148 14:24646719-24646741 TTTTCTGTTTTCTTCTCTTTTGG - Intergenic
1114740387 14:25090856-25090878 TTTTTTTTCTTTTTCTCTGTGGG + Intergenic
1115428303 14:33286811-33286833 TTTTCTATCTTCTTCACAGTGGG - Intronic
1115782525 14:36785460-36785482 TTTTCTCTCATCTACCCTGGAGG + Intronic
1115989250 14:39134997-39135019 TTTTTTCCTTTCAGCTCTGTTGG + Intronic
1116095081 14:40357314-40357336 TTTCATCTCTTCTGCCATGTGGG - Intergenic
1116226371 14:42158391-42158413 TGTTCTCTATTCTGTTCTATTGG - Intergenic
1116419084 14:44712590-44712612 TTTTCTGACTTCCCCTCTGTAGG + Intergenic
1116465786 14:45231113-45231135 TTTTGTCTTTACTTCTCTGTTGG - Intronic
1116497375 14:45577916-45577938 TGTTCTCTCTTCTGTTCCATTGG + Intergenic
1116562436 14:46397768-46397790 TTTTTTCTCTTCAGCTCTTAAGG - Intergenic
1116777954 14:49203233-49203255 TTTTTTCTCTACTGTTCTGATGG - Intergenic
1117204395 14:53426139-53426161 TTTTCTCTTTTGTTCTTTGTTGG - Intergenic
1117440263 14:55753042-55753064 TTTCCTTTCTGCTGTTCTGTGGG + Intergenic
1117489396 14:56230985-56231007 CTTTGTCTCTTTTGATCTGTTGG - Intronic
1117558722 14:56912914-56912936 CTCTCTCTCTGCTGGTCTGTTGG + Intergenic
1118052047 14:62040032-62040054 TTTTTTCTCTTTTACTGTGTTGG + Intronic
1118376992 14:65185993-65186015 TGTGTTCTCCTCTGCTCTGTGGG + Intergenic
1118465211 14:66024534-66024556 TCCTCTGTCTTGTGCTCTGTTGG - Intergenic
1118661092 14:68013331-68013353 TTATTTCTATTTTGCTCTGTTGG + Intronic
1119552441 14:75524756-75524778 TTTTATCACCTCTCCTCTGTAGG - Intronic
1119678975 14:76577715-76577737 CATTCTCTCTTCTGGTCTGAAGG - Intergenic
1119894259 14:78206533-78206555 TTTCCTCTCTTGGGCTCTCTGGG - Intergenic
1120014855 14:79460444-79460466 TTTTCTCTCATCAGCTCCTTTGG + Intronic
1120057898 14:79947164-79947186 TTTTAACTCTTCTGCATTGTAGG - Intergenic
1120358318 14:83461805-83461827 TTTGGTTTGTTCTGCTCTGTTGG - Intergenic
1120607104 14:86593004-86593026 TTTTCTCTTTTCTTCTTTATTGG - Intergenic
1120608678 14:86611361-86611383 TTTTCTCTTTTCTTCTTTATTGG + Intergenic
1121257855 14:92544378-92544400 TTCTCTGGCTTCTGCTCTGGTGG + Intronic
1121735029 14:96212443-96212465 TTTTCTTTCTTCTACTTTTTTGG - Intronic
1122644620 14:103185904-103185926 TTTTATTTCATCTGCTTTGTAGG - Intergenic
1123404486 15:20011802-20011824 TCTCCTCTCTTCGCCTCTGTGGG - Intergenic
1123513819 15:21018449-21018471 TCTCCTCTCTTCGCCTCTGTGGG - Intergenic
1123568321 15:21574840-21574862 TTTTATTTCTTCTTCTCTTTGGG - Intergenic
1123604429 15:22010162-22010184 TTTTATTTCTTCTTCTCTTTGGG - Intergenic
1123655132 15:22509930-22509952 GATTCTCTATTCTGTTCTGTTGG - Intergenic
1123959752 15:25384823-25384845 TGTTCTCTCTTCTGCTCACTTGG - Intronic
1125011655 15:34883324-34883346 CATACTCTTTTCTGCTCTGTTGG - Intronic
1125113647 15:36063454-36063476 TTTCCTCTATTCTGTTCTTTAGG - Intergenic
1125384352 15:39121630-39121652 TTTTCTCTCTTCTGCCTCCTAGG - Intergenic
1125836059 15:42752521-42752543 TTTTCTCTCTCTTGCCCTCTTGG + Exonic
1125925103 15:43556703-43556725 TTTTCTCTGTTCTAATTTGTTGG - Intronic
1126435698 15:48635243-48635265 CTTTCTCTCTTCCGCTCTGAGGG + Intronic
1126696797 15:51333216-51333238 TTTTCTTTTGTCTGCTCTCTGGG + Intronic
1126704490 15:51394918-51394940 TTTTCTCCCTTCTGCCCTGGTGG - Exonic
1127177591 15:56377086-56377108 TTTTCTCTATTCTGTTCCATTGG + Intronic
1127331892 15:57947931-57947953 TTTTCTCTCTGCTGTCCTTTAGG + Intergenic
1127882023 15:63166626-63166648 TTTACTCTCACCTGCCCTGTAGG - Intergenic
1128030434 15:64475175-64475197 TTTTTTCTCTTCTGTTCTGTTGG + Intronic
1128251191 15:66165461-66165483 CTTTCTCTCTTCTGTGCTGGTGG - Intronic
1128401439 15:67285783-67285805 GGTTCTCTATTCTGTTCTGTTGG + Intronic
1128737978 15:70064313-70064335 GGTTCCCGCTTCTGCTCTGTGGG - Intronic
1130357554 15:83147611-83147633 GGTTCTCTATTCTGTTCTGTTGG - Intronic
1130708376 15:86254890-86254912 TTTGCTGTCTGCTGCACTGTAGG - Intronic
1130819514 15:87479635-87479657 TTTTCTCTCCTCTGTTTTGGGGG + Intergenic
1131646065 15:94346130-94346152 GTTTCTCTCTTTCGCTCTCTCGG - Intronic
1133082598 16:3334702-3334724 TGTTCTCTATTCTGCTCCATTGG + Intergenic
1133455619 16:5940079-5940101 TTTTCCATCTTCTGCCCTGAAGG + Intergenic
1134008827 16:10836117-10836139 TTTTATCTGTTCTGTTATGTAGG + Intergenic
1135095767 16:19563514-19563536 TTCTCTCTCTCCTCCTCTTTGGG + Intronic
1135692906 16:24558402-24558424 TTTTCTCTCTTTTGGGCAGTGGG + Intronic
1136016138 16:27402374-27402396 TCCTCTGTCTGCTGCTCTGTGGG + Exonic
1136108729 16:28051221-28051243 TTTTCTGACTTATGCCCTGTTGG - Intronic
1136280778 16:29209887-29209909 TTTTTTCTCTTCTCCTTTCTGGG - Intergenic
1136598943 16:31271219-31271241 GAGTCTCTTTTCTGCTCTGTTGG + Intronic
1136671048 16:31858321-31858343 AATTCTCTATTCTGCTCTATTGG - Intergenic
1137308925 16:47233915-47233937 TTTTGTCTCCTCTGGTGTGTCGG - Intronic
1138264239 16:55648376-55648398 GACTCTCTCTTCTGTTCTGTTGG - Intergenic
1138871808 16:60898117-60898139 TTTTCTGTCTTCATTTCTGTTGG - Intergenic
1139719309 16:68840122-68840144 TTTTATCTCTCAGGCTCTGTGGG - Intergenic
1139727438 16:68912754-68912776 TCTCTTCTCTCCTGCTCTGTTGG - Intronic
1139951296 16:70672424-70672446 TTTTCTCTCTCCTGTCCTGCTGG - Intronic
1140148985 16:72342361-72342383 TTGTCTCTTTTCTTCTTTGTTGG - Intergenic
1140852195 16:78945578-78945600 TTTTCTCTCTTTTGGTTTGTTGG + Intronic
1140926792 16:79590819-79590841 CTTCCTCTCCTCTGCTCTCTGGG + Intronic
1140990155 16:80202996-80203018 TTTTCTCTCTCTTGTTCAGTAGG + Intergenic
1142067606 16:88071799-88071821 TTCCCTTTTTTCTGCTCTGTAGG + Intronic
1142437032 16:90066870-90066892 TTTACTCTGTTCTCCTCTGAAGG + Exonic
1142485365 17:244309-244331 TTTTCTTTCTCATGCCCTGTTGG - Intronic
1142650514 17:1348073-1348095 TTTCCTTTGTCCTGCTCTGTTGG - Intronic
1143998315 17:11028593-11028615 TGTTCTCTCTTGTTCTCTGCTGG + Intergenic
1144706115 17:17369080-17369102 TTTCCTCTCTTCTGCTATTTGGG - Intergenic
1145043107 17:19591508-19591530 TTTTCTCTCTGCTGCTCTTCTGG + Intergenic
1145989836 17:29072660-29072682 TTTTCTCCCTTCTTCCCTTTTGG + Intergenic
1147462923 17:40586421-40586443 TTTCCTTTCTTCTGCTGGGTTGG + Intergenic
1149249169 17:54748523-54748545 TTTTCTCTATTCTGTTCTATTGG + Intergenic
1149766965 17:59287246-59287268 TTTTCTGTCTTCTGTTCTCTTGG + Intergenic
1149775049 17:59350732-59350754 TTCTCTCACTTCTCCTCTGAAGG - Intronic
1149822811 17:59796057-59796079 TTTGCTCTCTCTTGCTTTGTAGG + Intronic
1149916804 17:60616944-60616966 TTTTCTTTCTTTTACTCTTTAGG + Intronic
1150056946 17:62025993-62026015 TTTTCTTACATTTGCTCTGTTGG - Intronic
1150560437 17:66289710-66289732 TTCTCTCTCTCTTGGTCTGTTGG - Intergenic
1150867527 17:68869478-68869500 TTTTTTCACTTTTGCTTTGTGGG - Intronic
1150932458 17:69599853-69599875 TGTTTTCTCTTCTGTTCTTTCGG + Intergenic
1151386500 17:73758299-73758321 TTTTCTTTTTTCCGCTCTGATGG + Intergenic
1151448226 17:74181214-74181236 GTTTCTCTCCTCTGCACTTTAGG + Intergenic
1151925192 17:77190765-77190787 TTTGCTCACTTCTGCTTTCTTGG + Intronic
1152107226 17:78337722-78337744 CATTCTCACTTCTGCTTTGTGGG - Intergenic
1153531432 18:6050708-6050730 TTTTTTCTCTTCTTCTCTTAGGG + Intronic
1153752119 18:8243355-8243377 TTTTTAACCTTCTGCTCTGTAGG + Intronic
1154525001 18:15278167-15278189 GTCTTTCTCTTTTGCTCTGTTGG + Intergenic
1154994972 18:21631785-21631807 TTTTCCATCTTCTGACCTGTTGG + Intergenic
1155360361 18:24993637-24993659 CTCTCTCTCTTTTCCTCTGTAGG + Intergenic
1155531204 18:26768495-26768517 TTTTCTCTCTCCTGATCTGTCGG - Intergenic
1155845404 18:30699409-30699431 TTTTCTCTCTTTGTCTCTCTGGG - Intergenic
1156002630 18:32402480-32402502 AATTCTCTTTTCTGCTCTTTTGG + Intronic
1156146818 18:34192520-34192542 GGTTATCTATTCTGCTCTGTTGG - Intronic
1156298280 18:35812663-35812685 TTCTCTCTTTTCTTCTTTGTTGG - Intergenic
1156604561 18:38651116-38651138 CTTCCTCTCTTCAGCTCTATAGG - Intergenic
1156810730 18:41247050-41247072 AATTCTCTATTCTGTTCTGTTGG + Intergenic
1156911486 18:42416123-42416145 TTATATTTCCTCTGCTCTGTAGG + Intergenic
1157004228 18:43562304-43562326 TTTTCTCTCTTCTTCCCTATTGG + Intergenic
1157151004 18:45217951-45217973 TCTTCACCCTTCTGATCTGTGGG + Intronic
1157163082 18:45332598-45332620 TTTCCTCTCTTCTACTATTTTGG - Intronic
1157587382 18:48813049-48813071 ATTTATCTATTCTGCTCTCTAGG + Intronic
1157968442 18:52237259-52237281 TGTTCAATCTTCTGCTATGTTGG - Intergenic
1158830969 18:61278119-61278141 TCTTCCCTCTTCTTCTCTTTGGG - Intergenic
1158921193 18:62192717-62192739 AATGCTCTCTTCTGTTCTGTTGG + Intronic
1159605679 18:70472144-70472166 TTTTTTCTCTCCTGCATTGTTGG + Intergenic
1159939029 18:74391961-74391983 TTTTCCTGCTTCTGCTATGTAGG + Intergenic
1159996321 18:74968966-74968988 TTTTCTCTCTGCCCCTCTGTTGG + Intronic
1160471898 18:79143320-79143342 TTTTCACTCTTCTCCTGTGTTGG + Intronic
1161524861 19:4747946-4747968 TTTTCTCTCTATCTCTCTGTGGG + Intergenic
1162791492 19:13065347-13065369 TTCAATCTCTTCTGCTCTGATGG + Intronic
1162887670 19:13708136-13708158 TTTCCTCTCCTCTCCCCTGTTGG + Intergenic
1163569709 19:18073712-18073734 TTTTCTCTTTTCTGCAATTTGGG - Intronic
1163644252 19:18479317-18479339 TTTTCTGCTTTCTGCTCTGATGG - Intronic
1163741594 19:19017221-19017243 CTTTCTCACTGCTACTCTGTAGG - Intronic
1163986657 19:20959041-20959063 ATTTCTCTCTTCTGCTCCACTGG + Intergenic
1164843617 19:31413215-31413237 TTTTCTGTAACCTGCTCTGTAGG + Intergenic
1165962421 19:39546431-39546453 ATTTCTCTCTTCTGTTCCATGGG + Intergenic
1166246943 19:41535859-41535881 TTTTTTCTTTTCTGTTTTGTTGG + Intergenic
1167565460 19:50253571-50253593 TTTTCTTTCTTCTTCCCTGGGGG - Intronic
1168367636 19:55802825-55802847 GGTTCTCTATTCTGTTCTGTTGG - Intronic
925224056 2:2167285-2167307 TTTTTGCTCTTCTCCTCTGTTGG + Intronic
925491560 2:4400770-4400792 TTTTCTATCTCCTTTTCTGTGGG + Intergenic
925506975 2:4577350-4577372 TTTTCTTCTTTCTGCTTTGTGGG + Intergenic
925787890 2:7450714-7450736 TTTTCTGTTTTCTCTTCTGTGGG - Intergenic
925899636 2:8499688-8499710 TTTCCTCTCTCCTGTTCTTTTGG - Intergenic
925926417 2:8674180-8674202 TTTTCTCTCTGTTGTTCAGTTGG - Intergenic
926065254 2:9833946-9833968 GGTTCTCTATTCTGTTCTGTTGG - Intergenic
926682209 2:15672599-15672621 CTATCTCTCTTCATCTCTGTTGG + Intergenic
927049509 2:19313192-19313214 TTTTCTTTCTTCTTAACTGTTGG - Intergenic
927059239 2:19398859-19398881 TTTCCTCTCTTCTGGTCTCTAGG + Intergenic
927094008 2:19733999-19734021 TTTTCTTCCCTCTGCCCTGTGGG - Intergenic
928211517 2:29327355-29327377 ATGTCTCTCTTCCTCTCTGTGGG - Intronic
928230354 2:29493537-29493559 TTTTCTCTTTTATTCTCTGAGGG + Intronic
928686095 2:33750580-33750602 TTTCTTCTCTTCTACTCTATGGG + Intergenic
928804030 2:35128989-35129011 AGGTCTCTGTTCTGCTCTGTTGG - Intergenic
928936027 2:36679019-36679041 TTTTCTCTCTTCTACTTTTGGGG + Intergenic
928981690 2:37142536-37142558 TTTTCTTTCTTCTGCTTTTTGGG + Intronic
929328928 2:40655259-40655281 TTTTTTCTCTACATCTCTGTCGG + Intergenic
929688642 2:44056496-44056518 GTTTCTCTCTTCCTCTCTCTAGG + Intergenic
930396136 2:50826956-50826978 CTTGCTGACTTCTGCTCTGTTGG - Intronic
930455339 2:51601310-51601332 AGTTCTCTATTCTGTTCTGTTGG + Intergenic
930917570 2:56712399-56712421 ACTTCTCTCATCTGCTCTGGAGG + Intergenic
930928242 2:56847892-56847914 GCTTCTCTATTCTGTTCTGTTGG + Intergenic
931222791 2:60303267-60303289 TTTTACTTCTTCTGGTCTGTTGG + Intergenic
931225267 2:60323967-60323989 TTTTGTCTCTTCTTCTCTCTGGG - Intergenic
931261834 2:60626732-60626754 TTTTTTTTCTTCTGCTCCCTTGG - Intergenic
931469878 2:62528660-62528682 TTTCCTTTCATCTGCTCAGTAGG - Intergenic
931620313 2:64203863-64203885 TTTTTTTTCTTCTTCTTTGTGGG + Intergenic
931686704 2:64800156-64800178 TTTTCTCACACCTGCTATGTTGG + Intergenic
931760621 2:65413467-65413489 TTTCCTCTCTTCTCTTCTGTTGG - Intronic
931908276 2:66866776-66866798 TTTTCTTTCTCCTGCTGAGTTGG + Intergenic
931927419 2:67088368-67088390 TTTTTTCCCATCTCCTCTGTCGG + Intergenic
931951373 2:67366525-67366547 TTTTCTTTCCTCTGCTTTCTGGG - Intergenic
932939111 2:76140878-76140900 TTTTCTCTCTTCTTCCCTTCTGG + Intergenic
933209174 2:79546396-79546418 GTTTCTCTATTCTACTCTGAAGG - Intronic
933482230 2:82871848-82871870 TTGTCTGTCTTCTGTTCCGTTGG + Intergenic
933517263 2:83320635-83320657 TTCTCTCTTCTCTGTTCTGTTGG - Intergenic
934640139 2:96023018-96023040 TCTTCTCTCTTCTGCAGAGTTGG - Exonic
934793506 2:97082382-97082404 TCTTCTCTCTTCTGCAGAGTCGG + Intergenic
935894597 2:107720934-107720956 TTTTCTCTATTCTGCTTCCTCGG - Intergenic
936231802 2:110708830-110708852 TTTTTCCCCTTCTGCTCTTTGGG + Intergenic
936633446 2:114229652-114229674 TGTTCTCTCTTCTGTTCTGTTGG + Intergenic
936892849 2:117392551-117392573 TCTTCACTCTTCTGCTCTTCGGG + Intergenic
937173977 2:119907763-119907785 TGTTCTCTATTCTGTTCTGTTGG - Intronic
937561247 2:123226733-123226755 TGTTCTCTATTCTGTTCCGTTGG + Intergenic
938119394 2:128623116-128623138 GTTTCTCACGCCTGCTCTGTGGG - Intergenic
938524191 2:132110286-132110308 GTCTTTCTCTTTTGCTCTGTTGG + Intergenic
938816873 2:134913571-134913593 GGTTCTCTATTCTGTTCTGTTGG + Intergenic
939116095 2:138062564-138062586 ATGTCTCTCTTCTGTTCTCTGGG - Intergenic
940091058 2:149917661-149917683 TTTTCTATTTTCTCCTCTGATGG - Intergenic
940159822 2:150699510-150699532 CTTTCTCTCTTATGTTTTGTTGG - Intergenic
940463367 2:153997003-153997025 GCTTCTCTATTCTGTTCTGTTGG + Intronic
940543208 2:155048254-155048276 TTTTTCCTCTTCTGATATGTAGG + Intergenic
940598959 2:155833324-155833346 TTCACTCTCTTCTTCTTTGTGGG + Intergenic
940892972 2:159053262-159053284 TTTTTTCCCTTAAGCTCTGTTGG - Intronic
940900992 2:159126039-159126061 TTTTCTCACTTCTGCTTTCGAGG + Intronic
940950591 2:159668627-159668649 TTTTCTCTCATCTGTTTTTTGGG + Intergenic
941083759 2:161092397-161092419 GTTTCTCTCTTCTAATCTGGAGG + Intergenic
941540050 2:166770897-166770919 TTTTTTGTCTTCTGCTAGGTTGG - Intergenic
941549297 2:166894970-166894992 TCTTCTCTCTCCTGTTCTGCTGG - Intronic
941771045 2:169346219-169346241 TGTTCTCTCGTCTGCACTGTTGG + Intronic
942110823 2:172681195-172681217 TTTTCACTCCTTTCCTCTGTGGG - Intergenic
942350098 2:175043369-175043391 AAGTCTCTGTTCTGCTCTGTTGG + Intergenic
942735963 2:179112917-179112939 TTTTCTCTCTTTTTTTTTGTGGG - Intronic
942828996 2:180216222-180216244 TTTCATGTCTTCTGCTATGTTGG - Intergenic
944074081 2:195707525-195707547 TCTCCTCTCTTCTGCACTCTTGG + Intronic
944452083 2:199853445-199853467 TTTACCCTCTTCAGCTCAGTTGG - Intergenic
944722872 2:202441300-202441322 TTTTCTCTCTTCTACTTTGAAGG + Intronic
944770778 2:202912346-202912368 TTTTCTCCCCTCTGCTCCGGCGG + Intronic
945112441 2:206373603-206373625 GGCTCTCTCTTCTGTTCTGTTGG + Intergenic
945182973 2:207110877-207110899 TTAGCTGTCTTCTTCTCTGTAGG - Intronic
945524434 2:210870725-210870747 AGTTCTCTCTTCTGGTCTGTTGG - Intergenic
945960789 2:216132758-216132780 TTTTCTCTATTCCTCTCTCTTGG + Intronic
946651899 2:221900924-221900946 TTTTGTCTCCTCAGCTCTGTAGG - Intergenic
946651939 2:221901533-221901555 TTTTCTCTTTTCTCTTCTCTTGG - Intergenic
947486413 2:230553810-230553832 AGTTCTCTCTTCTGATCCGTTGG - Intergenic
947519683 2:230835387-230835409 TTTTATCTTATCTCCTCTGTTGG - Intergenic
947590508 2:231382605-231382627 GCTTTTCTCTTCTGCTCTGTTGG + Intergenic
948387533 2:237590984-237591006 TCTTTTCTCTTCTGGGCTGTTGG - Exonic
948543625 2:238708786-238708808 TTTTCTCTCTTCTCTTCTTCTGG + Intergenic
948622087 2:239242044-239242066 TTTTCTCTTTTCTTTTCTTTTGG - Intronic
948707899 2:239806549-239806571 TTCTCTCTCATCTGCTCTCTGGG + Intergenic
949074915 2:242049044-242049066 TATTCTCTCTTCTTCTGTTTTGG - Intergenic
1168983659 20:2028715-2028737 ATTTCTCTCCTCTGCTCCCTCGG - Intergenic
1169019170 20:2315901-2315923 TTTTCTCTCTACTTTTATGTAGG - Intronic
1169578444 20:6992005-6992027 TTTTCTCTTCTCTGCCCTGTGGG - Intergenic
1170079322 20:12454502-12454524 TTTTCTCATTTCTGCTCTAATGG + Intergenic
1170312596 20:15008893-15008915 TTTTCTCTTTCCTTTTCTGTGGG + Intronic
1170865112 20:20148083-20148105 GGTTCTCTGTTCTGTTCTGTTGG + Intronic
1170865746 20:20155083-20155105 GGTTCTCTATTCTGTTCTGTTGG - Intronic
1171078194 20:22150362-22150384 TTTTGTCTCTTCTGCTATTTTGG + Intergenic
1172219271 20:33261674-33261696 CTTTCTCTCTCTTGCTCTCTTGG - Intergenic
1173265646 20:41477654-41477676 TTTTATCACTTCTGTTCTTTTGG - Intronic
1173281245 20:41630185-41630207 GGTTCTCTATTCTGTTCTGTTGG + Intergenic
1173639509 20:44590870-44590892 TTCTCTCTCTTCAGCACTGTAGG + Intronic
1173678078 20:44855443-44855465 CTTTCTCTCTTCTACTTTTTTGG - Intergenic
1174397760 20:50258575-50258597 TTTTCTATCTTCTGCCCCTTTGG + Intergenic
1174645617 20:52082881-52082903 TTTACTCACCTCTGCTCTATTGG + Intronic
1175065491 20:56282964-56282986 GGTTCTCTCTTCTGCTCCGATGG - Intergenic
1175430204 20:58896309-58896331 TGTTCCCTCTTCTTTTCTGTAGG - Intronic
1175467828 20:59204526-59204548 TTTGCTTTGTTCTTCTCTGTGGG + Intronic
1175660812 20:60810421-60810443 TTTTCTCTCTTAGTTTCTGTGGG + Intergenic
1176031217 20:63013308-63013330 TGTTCTCTCATCTCCTCTCTGGG + Intergenic
1176772433 21:13090316-13090338 GTCTTTCTCTTTTGCTCTGTTGG - Intergenic
1177081718 21:16647557-16647579 TTTTCACTCTTTTTCTCTCTGGG + Intergenic
1177234112 21:18364031-18364053 TTTTCTCACATCTCCTCTCTGGG + Intronic
1177464721 21:21460867-21460889 TCTTCTCTCTTCTGTGCTGACGG - Intronic
1177876709 21:26642291-26642313 AATTCTCTATTCTGTTCTGTTGG + Intergenic
1177922504 21:27169849-27169871 TTTTATCTGTTCTGTTCTTTTGG + Intergenic
1178109786 21:29358328-29358350 TTTTCTCTTTTGTCCTCTGCAGG - Intronic
1178136228 21:29630517-29630539 TTTGCTCTCTTCTGGTCTTAAGG + Intronic
1178164131 21:29952581-29952603 TTTTCTCTCTTTTCTTTTGTTGG - Intergenic
1178211880 21:30544067-30544089 GGTTCTCTCTTCTGTTCCGTTGG + Intronic
1178382051 21:32118639-32118661 TTATCTCTCTCCCTCTCTGTGGG - Intergenic
1180454507 22:15500531-15500553 GGTTCTCTCTTCTGTTCTATTGG + Intergenic
1180457902 22:15528504-15528526 TTTTATTTCTTCTTCTCTTTGGG + Exonic
1180536993 22:16402612-16402634 TGTTCTCTCTTCTGTTCCATTGG - Intergenic
1180820658 22:18825079-18825101 TGTTCTCTCGCCTGCTCTTTAGG - Intergenic
1181192315 22:21150968-21150990 TGTTCTCTCGCCTGCTCTTTAGG + Intergenic
1181206881 22:21259551-21259573 TGTTCTCTCGCCTGCTCTTTAGG - Intergenic
1182320104 22:29473247-29473269 TTGTCTCTCTGCAGCTGTGTGGG - Intergenic
1182344026 22:29647228-29647250 TTTTCTCTCTTCTGATCACTAGG - Intronic
1182924250 22:34107763-34107785 TATTCTCTTTCCTGCTCTGGTGG + Intergenic
1184105669 22:42366280-42366302 TTTGCTCCCTTCTGTTCTGTGGG - Intergenic
1185223702 22:49641512-49641534 CTTCCTCTCCTCTGCTCAGTGGG + Intronic
1185270433 22:49927074-49927096 TCATCTCTCATCTGCTTTGTGGG + Intronic
1185280341 22:49967169-49967191 TTATCTCCCCTGTGCTCTGTGGG + Intergenic
1203220042 22_KI270731v1_random:35872-35894 TGTTCTCTCGCCTGCTCTTTAGG + Intergenic
1203270784 22_KI270734v1_random:50954-50976 TGTTCTCTCGCCTGCTCTTTAGG - Intergenic
949428327 3:3943616-3943638 TGTTCTCTATTCTGCTCCATTGG + Intronic
949632902 3:5948600-5948622 TTTTCTCATTTCTGCTCTTATGG + Intergenic
950116548 3:10454157-10454179 TTGTCTCTCTTCTTCACTGTGGG - Intronic
950910789 3:16589269-16589291 TTTTCTCTCTGCACATCTGTAGG - Intronic
951057779 3:18168013-18168035 ATTTCTCTCTTCTTTTCTGGAGG - Intronic
951445281 3:22772583-22772605 TTTTCTCTGTTCTGTTCCATTGG + Intergenic
951709904 3:25576869-25576891 TCTCCTCTCTTCTCTTCTGTTGG + Intronic
951765502 3:26193929-26193951 TTTTCTCTCCTCTCTTCTGAAGG - Intergenic
952042487 3:29277618-29277640 TTATATCATTTCTGCTCTGTTGG - Intergenic
952640938 3:35594783-35594805 TTTTCTCTCTTCTGTTTTCTGGG - Intergenic
952988738 3:38812369-38812391 TCTTATCTCTTCTGCTCAGTAGG + Intergenic
953070068 3:39511344-39511366 TTTCCTCTATTCAGCTATGTGGG + Intronic
953204818 3:40816170-40816192 ATTTCTATTTTCTGCTCTATGGG - Intergenic
953298195 3:41743013-41743035 TTCTCTCTCTTCCCCTCTTTGGG - Intronic
953348727 3:42198335-42198357 GTTTCTCTCTCCAGCTTTGTGGG - Intronic
953593784 3:44287851-44287873 TTTTCTCTTTTATTCTCTGATGG + Intronic
953721620 3:45360806-45360828 TTTTCTCTCTTCTTTCCTCTGGG + Intergenic
953937836 3:47061317-47061339 CATTCTCTATTCTGTTCTGTTGG - Intronic
954308779 3:49748168-49748190 CTTCCTCTCTTCTTTTCTGTAGG - Exonic
955020220 3:55113348-55113370 GGCTCTCTTTTCTGCTCTGTTGG - Intergenic
955479214 3:59372312-59372334 TCTTCTCTCTTCAGCTCAATGGG + Intergenic
955546687 3:60038724-60038746 GTTGCTTTCTTCTGCTCTATTGG - Intronic
955553443 3:60109562-60109584 CTTTCTCTGTTCTGCTTTGCTGG - Intronic
956233922 3:67045224-67045246 TTTAATCTCTTCTTTTCTGTCGG + Intergenic
956346085 3:68280623-68280645 TTTTCCCCCTTCTGCACAGTGGG + Intronic
956385597 3:68715143-68715165 TTTGTTTTCTTCTGCTCTTTGGG - Intergenic
956457064 3:69432340-69432362 TTTTGTTTATTTTGCTCTGTGGG + Intronic
956728227 3:72174208-72174230 TTCTCTCTCTCCTGCTGTGAAGG + Intergenic
956901876 3:73725286-73725308 TTTTCTCTTTTTTGCTGTTTTGG + Intergenic
957015842 3:75064149-75064171 GTTTCTCTATTCTGTTCTATTGG + Intergenic
957566859 3:81895165-81895187 CTTTCTTGCTTCTGCTTTGTCGG - Intergenic
957972059 3:87395005-87395027 GGTTCTCTATTCTGTTCTGTTGG - Intergenic
958104984 3:89060038-89060060 CATTCTCTCTTCTGATCTATCGG - Intergenic
958505867 3:94976259-94976281 TTTCCTTTCTTCTGCTGGGTGGG - Intergenic
958687607 3:97419707-97419729 TTTTCTCACTTTTGCTCTTGTGG - Intronic
958760312 3:98298299-98298321 TTTTCTTTCATCTCCTCTGATGG - Intergenic
959259388 3:104055821-104055843 ATTTCTCTATTCTGTTCTGTTGG - Intergenic
959364939 3:105445640-105445662 TCTTCTCTATTCTGTTCTGTTGG - Intronic
959369832 3:105509546-105509568 TTTTTTATCTGCTTCTCTGTGGG + Intronic
960155546 3:114294137-114294159 TTTCCTCCCTGCTGCTCTGCTGG - Intronic
960427718 3:117529520-117529542 GGTTCTCTATTCTGTTCTGTTGG + Intergenic
960545764 3:118913059-118913081 TGTTCTCTCTTCTACTCTGATGG - Intronic
960681828 3:120256353-120256375 GGTTCTCTCTTCTGTTCTATTGG - Intronic
961110821 3:124281616-124281638 CTCTCTCTGTTCTGCCCTGTTGG + Intronic
961432964 3:126896286-126896308 TTCTCTCTCCTCTGCTCTTTGGG + Intronic
961495391 3:127287713-127287735 TTTTCTCTCTTCCGCTAAGGAGG - Intergenic
961523828 3:127484068-127484090 CTTTCTCATTTCTGCTCTGGTGG - Intergenic
961728270 3:128947553-128947575 GTTTCTCTTTTCTGATCCGTGGG - Intronic
961998049 3:131267600-131267622 TTCTCTCTCTTCTGGCTTGTAGG + Intronic
962036252 3:131654719-131654741 TTTACTCTCTCCTTCTTTGTTGG - Intronic
962419223 3:135213731-135213753 TTCTTTCTCTTCTGATCAGTAGG + Intronic
962881957 3:139586785-139586807 TTTTCTTTTTACTGCTCTGTGGG - Intronic
963352706 3:144171557-144171579 TTTTCTCTCAAGTGCACTGTTGG + Intergenic
963652879 3:148006566-148006588 TCTTATCTCTCTTGCTCTGTAGG + Intergenic
963752706 3:149199703-149199725 TATACTCACTTCTGCTCTGGGGG + Exonic
963878898 3:150505221-150505243 TTTTCTCTCTGTGGCTGTGTTGG - Intergenic
964026266 3:152078584-152078606 TGTTAACTCTTCTGCTCTTTCGG + Intergenic
964283066 3:155088066-155088088 TTTTCTTCATTCTGCTCTGTTGG + Intronic
965006996 3:163040317-163040339 TTTTCTATGTTGTGCCCTGTGGG + Intergenic
965053050 3:163676210-163676232 TGTTCTCTATTCTGCTCCTTTGG - Intergenic
965245980 3:166269151-166269173 TATTGTCTCTTGTGGTCTGTAGG + Intergenic
965631390 3:170736739-170736761 GGTTCTCTATTCTGCTCTGTTGG - Intronic
965850080 3:173012587-173012609 GATTCTCTGTTCTGTTCTGTAGG - Intronic
966060590 3:175749529-175749551 TTTCCCCTCTTCTGCCATGTTGG - Intronic
966153791 3:176893854-176893876 AGTTCTCTATTCTGTTCTGTTGG - Intergenic
966363881 3:179161261-179161283 TTTTCTATCTTCTTGTCTCTAGG + Intronic
966450747 3:180058453-180058475 TTGTATCTCTTGTGTTCTGTGGG - Intergenic
966685314 3:182687311-182687333 TTTTCTCTATTCTCCTCTCAAGG - Intergenic
966926317 3:184646875-184646897 TTTTCTCTCTTCTTGTTTCTTGG - Intronic
968255924 3:197271440-197271462 TTCCCTCACTTCTGCTCTCTAGG + Intronic
968694740 4:2018378-2018400 GTTTCTCTGTCCTGCACTGTTGG + Intronic
968732120 4:2274122-2274144 TCTTCTCTCTTGTGGCCTGTGGG + Exonic
969407182 4:7001303-7001325 TTCTCTCCCTTTTGCCCTGTTGG + Intronic
969932385 4:10643417-10643439 TTTTCTTACTTCTGAACTGTAGG - Intronic
970173902 4:13317656-13317678 TGTTCTCTATTCTGTTCCGTTGG + Intergenic
970351862 4:15209564-15209586 TCTTCTGTCTTCTGCCATGTAGG - Intergenic
970971621 4:21990727-21990749 TTTTCTCTCTTTTCATCTTTGGG - Intergenic
971558581 4:28044989-28045011 GGTTCTCTATTCTGTTCTGTTGG + Intergenic
971798698 4:31260415-31260437 TGTTCTTTCTTCCTCTCTGTGGG + Intergenic
971940510 4:33208930-33208952 AGTTCTCTATTCTGTTCTGTTGG - Intergenic
972053455 4:34769886-34769908 TTTTTTCTCTTTTTCTTTGTAGG + Intergenic
972419653 4:38875004-38875026 AGTTCTCTATTCTGTTCTGTTGG + Intronic
972577162 4:40362646-40362668 TTTTCTGTCTTCTTTTGTGTTGG - Intergenic
972991534 4:44827340-44827362 TGTTCTCTCTACTGCTGTGGGGG + Intergenic
972994243 4:44860330-44860352 TTTGCTTTCTTTTGCTCTGAAGG + Intergenic
973544649 4:51968584-51968606 AGTTCTCTATTCTGTTCTGTTGG + Intergenic
973709089 4:53609069-53609091 GGTTCTCTATTCTGTTCTGTTGG - Intronic
973738046 4:53891820-53891842 TTTTCAATCTTCTGTTCTGGTGG - Intronic
974158016 4:58099860-58099882 GGTTCTCTGTTCTGTTCTGTTGG + Intergenic
974190769 4:58499474-58499496 TTTTCTGTCTGCTTCTCTATTGG + Intergenic
974233068 4:59142661-59142683 CTTTCTCTCTTATGCTCAGAAGG - Intergenic
974237728 4:59204076-59204098 TTTGTTGTCTTCTGCTCTGTAGG + Intergenic
974650731 4:64750611-64750633 TTTTCTCTCATCTCCTTTTTAGG - Intergenic
974772320 4:66432921-66432943 ATCTCCCTCTTCTGCTCAGTAGG - Intergenic
974925169 4:68289122-68289144 TTTTCTATCTTCTGTTCTTTGGG - Intergenic
974953715 4:68613548-68613570 GGTTCTCTATTCTGTTCTGTTGG - Intronic
974986384 4:69031734-69031756 TTTTCTCCATGCTTCTCTGTAGG - Intronic
975349761 4:73331980-73332002 TTTTCTGTCTGCTACTTTGTTGG + Intergenic
975407861 4:74012558-74012580 TTTGCTGTCTTCTGCTCTTTTGG + Intergenic
975903261 4:79178972-79178994 TTCTCTCTCTCTTGCTCTCTGGG - Intergenic
976016710 4:80563580-80563602 TTTTCCCTCTTTTGTTATGTAGG - Intronic
976052817 4:81029281-81029303 TTATCCCTCTTCCCCTCTGTAGG - Intergenic
976762309 4:88562832-88562854 TGTTCTCTATTCTGTTCTATTGG + Intronic
977004551 4:91548727-91548749 TTTTTTCTTTGCTTCTCTGTAGG + Intronic
977125013 4:93154432-93154454 CTTTATCTCTTCTGATTTGTTGG + Intronic
977275313 4:94970316-94970338 CTTTCTCTCTTTTTCTCTTTCGG + Intronic
977552172 4:98453818-98453840 TTTCCTTTCTTCTGCTGAGTTGG + Intergenic
977904819 4:102464924-102464946 TTTTCTGTCATTTGCTCTTTGGG + Intergenic
977928587 4:102728680-102728702 TGTGCTCCCTTCTGCTCTCTGGG + Intronic
978114938 4:105008081-105008103 AGTTCTCTATTCTGTTCTGTTGG + Intergenic
978441041 4:108733490-108733512 GTTGCTCTCTTCTTCTCTCTAGG + Intergenic
979572563 4:122245910-122245932 TTTTCTGTCTGCTTCTCTGTAGG + Intronic
980469732 4:133235277-133235299 TATTCTCTCTCCTTCTCTCTCGG - Intergenic
980950418 4:139370274-139370296 TTTTTTCTCTTCTTCTATCTGGG - Exonic
981766540 4:148257042-148257064 TTTCCTCTTGTCTGCTCTCTAGG + Intronic
981869685 4:149471227-149471249 TTCTCTCTTTTCTTCTTTGTTGG - Intergenic
982077720 4:151754580-151754602 ATTTCATTCTTCTTCTCTGTCGG - Intronic
982099816 4:151957056-151957078 TTTTCTCTCTCTTTTTCTGTTGG + Intergenic
983149334 4:164258514-164258536 TTTTCTATCTTATGGTTTGTAGG + Intronic
983510124 4:168600795-168600817 TTTAGTCTCTTGTGCCCTGTTGG - Intronic
983763176 4:171440022-171440044 TGTTCTTTCTTCTGTGCTGTTGG + Intergenic
983793794 4:171833621-171833643 TTTCCACTCTTCTGCTCTTCTGG + Intronic
983877218 4:172891743-172891765 TATTCTTTCTTCTTCTCTCTCGG + Intronic
983881656 4:172939837-172939859 TTTTCTCATTTCTTCTCTGTGGG - Intronic
984825166 4:183917686-183917708 TCTTCACTGTTCTGCTCTCTGGG - Intronic
985208028 4:187561596-187561618 TTTTCATTCTTCTGCTCTGCTGG + Intergenic
985267656 4:188165008-188165030 TTTTCTCTCTGCTGAGGTGTAGG - Intergenic
985762452 5:1757216-1757238 TCTTCTCTCTTCAGCTCAGTCGG - Intergenic
986109323 5:4695756-4695778 TTTTCTCTTTTTTACTCAGTTGG - Intergenic
986964274 5:13251815-13251837 TTTTCTCTCTCCTCCTCTTGGGG - Intergenic
987189156 5:15455935-15455957 TATTCTCTATTCTGGTCTGTTGG + Intergenic
987189951 5:15466594-15466616 GTTTCTCTATTCTGTTCTCTTGG + Intergenic
987370262 5:17186583-17186605 CTTGCTCCCTGCTGCTCTGTGGG + Intronic
987552064 5:19396120-19396142 ATTTCTCTCTTTTCCTCTATTGG + Intergenic
987729145 5:21745280-21745302 TTTCTTCTCTTCTGCTCTGCTGG - Intergenic
987860288 5:23477555-23477577 TATTCTCTATTCTGTTCTGTTGG - Intergenic
987950604 5:24670100-24670122 TTTATTATCTGCTGCTCTGTAGG - Intergenic
988619630 5:32809858-32809880 TTTTCTCTCTTCCTCCCTATTGG + Intergenic
988688946 5:33552701-33552723 GGTTCTCTATTCTGATCTGTTGG + Intronic
988772391 5:34446135-34446157 TTCACTCTCTTCTGGTATGTAGG + Intergenic
988914023 5:35874489-35874511 TTTTTTCTCTGTCGCTCTGTTGG + Exonic
989070157 5:37501773-37501795 GGTTCTCTATTCTGTTCTGTTGG + Intronic
989618210 5:43358469-43358491 CTTTCTCTCTTCTCGTTTGTTGG + Intergenic
990662775 5:58036581-58036603 TATTCTCTATTCTGCTCCATTGG - Intergenic
991018378 5:61955566-61955588 GGTTCTCTATTCTGTTCTGTTGG + Intergenic
991318745 5:65343354-65343376 TGTTCTCTGTTCTGTTCTATTGG - Intronic
991340174 5:65600327-65600349 GGCTCTCTCTTCTGTTCTGTTGG - Intronic
991632883 5:68674420-68674442 TATTCTCTCTTCTGCTTTCAAGG + Intergenic
992131277 5:73695310-73695332 TTTCCTCTCCTCTGTTGTGTGGG + Intronic
993013745 5:82512393-82512415 TTTTTTCTCTTCTTCTATGAGGG - Intergenic
993120786 5:83771681-83771703 TTTTCTTTATTTTGCTCTTTGGG - Intergenic
993544725 5:89197181-89197203 TTCTCTCTCTTCTTCTTTATTGG + Intergenic
993853035 5:93035034-93035056 TTTTTTCTTTTTTTCTCTGTTGG - Intergenic
993919300 5:93780578-93780600 TTTTGGAGCTTCTGCTCTGTTGG + Intronic
994084364 5:95742489-95742511 TTTTCTCTATTCTCTTCTTTTGG + Intronic
994152125 5:96459622-96459644 TTTTCTCTCTTTCTCTCTGCTGG + Intergenic
994739933 5:103605419-103605441 CTTACTCACTTTTGCTCTGTTGG + Intergenic
994945347 5:106380793-106380815 TTTTCTGTCTTTTGCTTTGGAGG + Intergenic
995186237 5:109274349-109274371 GGTTCTCTATTCTGTTCTGTTGG - Intergenic
995311001 5:110711594-110711616 GATTCTCTCTTCTGCTCCATTGG - Intronic
995337706 5:111020324-111020346 TTTCCTCTGTTCTCTTCTGTTGG - Intergenic
995623287 5:114051577-114051599 TTATTTATATTCTGCTCTGTTGG + Intergenic
996193873 5:120579583-120579605 AGTTCTCTGTTCTGCTCTATTGG + Intronic
996459881 5:123729767-123729789 GTTTCTCTATTCTGCTCCATTGG - Intergenic
996465603 5:123799039-123799061 TCTTTTCTCATCTGGTCTGTGGG + Intergenic
996561660 5:124836425-124836447 TGTTCTCTCTTCTGTTCCGTTGG - Intergenic
996697241 5:126411434-126411456 GGTTCTCTATTCTGTTCTGTTGG + Intronic
998564904 5:143208164-143208186 TTTTTGCTCTTGTGCTCTTTGGG + Intronic
998758864 5:145410375-145410397 TTTTCTTTCTCCCACTCTGTGGG - Intergenic
999048202 5:148492198-148492220 TTTTCCCCCTTTTGCTCCGTAGG - Intronic
999385341 5:151150345-151150367 CTTTCCCTTTTCTGCTTTGTAGG + Intronic
999662498 5:153880418-153880440 TTTTCTCTGTTCTGTCCTTTGGG - Intergenic
999691474 5:154149434-154149456 TTTTCTTTCTTTCTCTCTGTTGG - Intronic
999947785 5:156616153-156616175 TATTCTGTCTTCAGCTCTGCTGG + Intronic
999956244 5:156705444-156705466 TTTTCTCTCTTCTCCTCTGCTGG + Intronic
1000360676 5:160443802-160443824 TTTTCTCTCTTTTGTTCTCATGG + Intergenic
1000493100 5:161940164-161940186 GGTTCTCTCTTCTGTTCCGTTGG + Intergenic
1000770871 5:165352038-165352060 TTATCTCTCTTCTGATTTCTGGG - Intergenic
1001129458 5:169051958-169051980 TTTTCTCTGTGCTGCCCTCTGGG - Intronic
1001145869 5:169184016-169184038 TTTAGTCTCTTCAGCCCTGTGGG - Intronic
1001177918 5:169489671-169489693 TTTTCTCTCTTCGTTTCTATTGG - Intergenic
1001733327 5:173976793-173976815 AGTTCTCTATTCTGTTCTGTTGG + Intronic
1001957054 5:175854960-175854982 GTTTATCTCTTCTGCTGGGTGGG - Intronic
1003361483 6:5430231-5430253 TTTTCTGTGTTCTTCTCAGTGGG + Intronic
1003822193 6:9911033-9911055 TTTCCTCTCCCCTGCTCTGAAGG - Intronic
1003851261 6:10225161-10225183 TTTTCTCTCTTGTTCACTGATGG - Intergenic
1004853368 6:19724216-19724238 TTTTTTCTCTTCTTCTCCATGGG + Intergenic
1004890881 6:20099341-20099363 TTTTTTCTCTTCTTGTCTCTGGG - Intergenic
1005296974 6:24436292-24436314 TTTTCTTTCTTCTGTGCTGTGGG + Intronic
1005305474 6:24509702-24509724 TTTTCTCTCTTCTCTTCTAATGG + Intronic
1005907831 6:30280220-30280242 GGTTCTCTATTCTGTTCTGTTGG + Intergenic
1005929614 6:30474044-30474066 TTTTTTTTCTTCTGCTCATTTGG - Intergenic
1006532968 6:34672776-34672798 TTTTCTCTGTTCTCCTTTATTGG - Intronic
1007063007 6:38959925-38959947 GTTTCTCTATTCTGCTCCATTGG - Intronic
1007290630 6:40783514-40783536 TTTCTTCCCTGCTGCTCTGTAGG - Intergenic
1007434179 6:41796732-41796754 TTTTCTCTCTTTTTCTCCTTTGG - Intronic
1007641098 6:43340354-43340376 TTTTCTTTCTTCTCCTCCTTTGG + Exonic
1007855721 6:44854342-44854364 TTGCTTCTCTTCTGGTCTGTAGG + Intronic
1007888601 6:45262321-45262343 GGTTCTCTATTCTGTTCTGTTGG - Intronic
1008255098 6:49288949-49288971 TTTTCTCTATTCTGTTCCATTGG + Intergenic
1008314368 6:50021897-50021919 TTTTCTTTATTCTGCACTTTTGG - Exonic
1008775022 6:55027698-55027720 GGTTCTCTATTCTGTTCTGTTGG + Intergenic
1008882240 6:56393158-56393180 TGTTCTCTCTTCTGTTCCATTGG - Intronic
1009315828 6:62219334-62219356 TTTTCTCTGTTCTGTTCTTCTGG - Intronic
1009739942 6:67731474-67731496 TTCTCTCTTTTCTTCTTTGTTGG + Intergenic
1009839933 6:69056774-69056796 TGTACTCTATTCTGTTCTGTTGG + Intronic
1010058321 6:71590655-71590677 AGTTCTCTTTTCTGTTCTGTAGG + Intergenic
1010788552 6:80034963-80034985 TTCTCTTTGTTCTACTCTGTAGG + Exonic
1010824170 6:80452492-80452514 TTTTCTCCTTTAAGCTCTGTGGG - Intergenic
1010847890 6:80733439-80733461 TTTTCTCTTCTGTGATCTGTAGG + Intergenic
1011005619 6:82641926-82641948 GATTCTCTATTCTGTTCTGTTGG - Intergenic
1011140463 6:84149703-84149725 TTTTCTTTCATTTGCTCTGTAGG - Exonic
1011751299 6:90457799-90457821 TTTTCTTTCTTTTCCACTGTGGG - Intergenic
1012095962 6:94961314-94961336 TTTTCACTTTTCTCCTCTTTTGG - Intergenic
1012445302 6:99301309-99301331 ATCTCTATCTTCTACTCTGTGGG + Intronic
1012915108 6:105161708-105161730 TTTTCTCTGTTCTGCTGTCTGGG - Exonic
1013206426 6:107950286-107950308 GTTTCTCTCTTCAGTTCTGTTGG - Intronic
1013495968 6:110697824-110697846 GGTTCTCTATTCTGTTCTGTTGG - Intronic
1013702727 6:112793660-112793682 CCTTCTCTCTACTGGTCTGTAGG + Intergenic
1013930884 6:115531317-115531339 TGTTCTCTATTCTGCTCCATTGG + Intergenic
1014068846 6:117158280-117158302 TTTTCTCTCTTCAAATCTTTTGG - Intergenic
1014938472 6:127411587-127411609 TGTACTCTCTTCTGGTTTGTAGG + Intergenic
1015130810 6:129806999-129807021 TTTTCTATCTGCTCCCCTGTAGG - Intergenic
1015222535 6:130821072-130821094 GGTTCTCTCTTCTGTTCTATTGG - Intergenic
1015472953 6:133627151-133627173 TCTACTCTCTGCTGCTCTGGAGG - Intergenic
1015648552 6:135425379-135425401 TCTCCTCTCTTTTACTCTGTTGG - Intronic
1015655947 6:135519310-135519332 TTCACTCTCTTCTGCTCTTCTGG - Intergenic
1015838503 6:137449660-137449682 TTTTCTGTCTTCTTTTCTATTGG + Intergenic
1015876566 6:137828592-137828614 TTTTCTCTCTTTTTCTGTATTGG - Intergenic
1015940357 6:138444390-138444412 TCTTCTATCATCTGCTATGTGGG - Intronic
1016741190 6:147530698-147530720 TTTGCTCTCTTCTTTTCAGTCGG - Intronic
1016790262 6:148060322-148060344 TTTTCCCTCTTCTGCCTTCTGGG + Intergenic
1017580750 6:155862271-155862293 GTTTCTCAATTCTGTTCTGTTGG + Intergenic
1018034526 6:159870815-159870837 ATTTCTCTATTCTGTTCTATTGG + Intergenic
1018190100 6:161303039-161303061 TCTTCTTTCTTATGTTCTGTTGG - Intergenic
1018281628 6:162192066-162192088 TTTTTTCTTTTATGCTTTGTAGG + Intronic
1018297222 6:162361602-162361624 TTTTCTCTCTCTTGGTCTGTCGG - Intronic
1019041084 6:169106746-169106768 TTTTCTTTCTTCTGTCCTTTTGG + Intergenic
1019936908 7:4263304-4263326 TCTTCTATGTTCTGCCCTGTAGG + Intronic
1020862063 7:13505958-13505980 TTTTCTCTATTCTCTTCTTTTGG + Intergenic
1021153050 7:17175760-17175782 TTTTCTAGCTTATGCTCTGAAGG + Intergenic
1021214272 7:17897337-17897359 TTTTATATCCTCTGCTTTGTGGG - Exonic
1021259335 7:18434074-18434096 GGTTCTCTATTCTGTTCTGTTGG - Intronic
1021339904 7:19452176-19452198 TGTTCTCTATTCTGTTCCGTTGG + Intergenic
1022346633 7:29522033-29522055 GGTTCTCTGTTCTGTTCTGTTGG + Intergenic
1022508265 7:30920258-30920280 TCCTCTCTCTTCTGCTCTCCAGG - Intronic
1022557493 7:31313193-31313215 TGTTCTCTGTTCTGGTCTGCCGG + Intergenic
1022762980 7:33377351-33377373 GGCTCTCTCTTCTGTTCTGTTGG + Intronic
1022986824 7:35663662-35663684 TTTTGTCTCTTTTGATCTGTTGG + Intronic
1023043344 7:36191617-36191639 TCTTCTCTCTTCTTCTGTGTGGG - Intronic
1023440335 7:40178938-40178960 ATTTTTTTGTTCTGCTCTGTAGG + Intronic
1023660311 7:42464382-42464404 TTTTCAGTCTTCTGTTATGTAGG - Intergenic
1023716582 7:43050836-43050858 TGTTCTCTTTTCTGTTCTGTTGG - Intergenic
1023994042 7:45148017-45148039 TTTTCTCACATCTGATCTCTGGG - Intergenic
1024166409 7:46736628-46736650 TTTCCTCCCTTCTGCTAGGTTGG - Intronic
1024206638 7:47168133-47168155 TTTACTTTCTCCAGCTCTGTGGG - Intergenic
1024440450 7:49410084-49410106 TTTTCTCCCCTCTTCTCTTTGGG - Intergenic
1024669754 7:51583822-51583844 TTTGAGCTCTTCTGCTCTTTTGG - Intergenic
1024691876 7:51811493-51811515 TTTTCTCTCTTTTCACCTGTGGG + Intergenic
1024731076 7:52254484-52254506 TTTTCACTCATCTGCTCTGAGGG - Intergenic
1024854355 7:53760338-53760360 TTTTCTCCCTTGTTCTCTTTGGG - Intergenic
1024904361 7:54359603-54359625 TTTTCTCTATTCTGCCCCTTTGG + Intergenic
1026112152 7:67466884-67466906 TTTCCTCTCTTCCTCTCTTTGGG - Intergenic
1026351739 7:69522393-69522415 ATTTCTCTCTTCAGTTCTGTTGG + Intergenic
1026496981 7:70911935-70911957 TTTTTTCTTTTCTTTTCTGTTGG - Intergenic
1027349965 7:77301517-77301539 TGTTCTCTGTTCTGTTCTATTGG + Intronic
1029266099 7:99341736-99341758 TTTTCCCTCTACTTCTCTTTTGG + Intronic
1029503869 7:100950333-100950355 GCTTCTCTCTTCTGCCCTGCAGG + Intronic
1029549615 7:101230728-101230750 TTCTCTCTCTTCTCCACTGCTGG - Intergenic
1030653119 7:112137058-112137080 TTCTCTCTCTTTTTCTCTTTTGG - Intronic
1031068499 7:117135042-117135064 TTTTCTCTCTTGTGGTCTGATGG + Intronic
1031195696 7:118610366-118610388 TCTTCTCTCTTGTTCTCTGATGG - Intergenic
1031462672 7:122070767-122070789 TATTCTCTCATCTTTTCTGTTGG + Intergenic
1031549934 7:123097189-123097211 TTTTCTCTCAACAGATCTGTTGG - Intergenic
1031586026 7:123533111-123533133 TTTTCTCCCCTCTGCTCCGGCGG - Intronic
1031631499 7:124048613-124048635 TTTTAGCTCTTTTTCTCTGTTGG + Intergenic
1032207335 7:129879061-129879083 TATTCTTTCTTCTGCTGTTTAGG + Intronic
1032233115 7:130093713-130093735 TTCTCTTTTTTCTGCTCTTTGGG + Intronic
1032776448 7:135118962-135118984 TTTTTTCTCTTATGTTCAGTTGG - Intronic
1032887680 7:136159465-136159487 TTTTTTCTCTTCTGATCCATTGG + Intergenic
1033110869 7:138574550-138574572 TTTTGTCTCATCTGCTATATTGG - Intronic
1033169866 7:139074019-139074041 TTCTCTCTCAGCTGTTCTGTAGG - Exonic
1033181901 7:139187872-139187894 TTTTTACTCTTCTACTCTTTTGG + Intronic
1033493890 7:141874137-141874159 TTTTCTATCTTCTTCTTTTTTGG + Intergenic
1034026636 7:147711811-147711833 ACTTCTCTCTTCTGTTGTGTGGG + Intronic
1034356190 7:150452123-150452145 TTTTCTCTCAGTTGCTCTGCTGG + Intronic
1034507477 7:151505079-151505101 TTTTCACTTTTAAGCTCTGTTGG - Intronic
1035711042 8:1714560-1714582 TTGTCTCTTTTCATCTCTGTTGG - Intergenic
1035834772 8:2737870-2737892 TTCTCTCTCTTCTCTTCTTTTGG - Intergenic
1036127626 8:6077856-6077878 TTTTCTCTCTTTTGTATTGTAGG - Intergenic
1036385740 8:8278926-8278948 TTTTCTCTGTTCTCTTCTTTAGG + Intergenic
1036400351 8:8402170-8402192 TTTTTTCTTTTCTGCTCTTGAGG - Intergenic
1036433460 8:8710962-8710984 GCCTCTCTCTTCTGCTCTGCAGG - Intergenic
1036914297 8:12790046-12790068 CTTTTTATCTTCTGGTCTGTAGG - Intergenic
1037021422 8:13976526-13976548 TTTTATCTTTTCTGGTCTTTTGG - Intergenic
1037353777 8:17995395-17995417 GGTTCTCTGTTCTGTTCTGTCGG + Intronic
1038032910 8:23660506-23660528 TTCTCTATCTTCTTCTGTGTTGG + Intergenic
1039279083 8:35962969-35962991 TCTTCTCTATTCTGTTCTATTGG + Intergenic
1039300393 8:36202837-36202859 TTCTTTCTCTATTGCTCTGTGGG + Intergenic
1039889903 8:41678461-41678483 TTTTCTTCCTTCTTTTCTGTTGG + Intronic
1040515637 8:48131861-48131883 TTTTCTAGATTCTGCTCGGTTGG + Intergenic
1040711812 8:50197988-50198010 ATCTCTCTCTTGTGTTCTGTTGG + Intronic
1040775022 8:51032182-51032204 TTTTATCTGTTCTGCTTTGTGGG + Intergenic
1040972415 8:53151028-53151050 TTTTCTCTCTTCTGAGAGGTGGG - Intergenic
1041009853 8:53530986-53531008 TTTGCTCTCTTCTGTTTGGTGGG - Intergenic
1041160242 8:55034220-55034242 TGTTCTCTCTCCAGCTCTGTAGG - Intergenic
1042115327 8:65425503-65425525 GTTTCTCTATTCTGTTCTATTGG + Intergenic
1042181833 8:66097279-66097301 TATTCTCTTTTCTGTTCTTTTGG + Intronic
1042191634 8:66193224-66193246 TTTTCTCTCATCCTCTCTCTTGG + Intergenic
1042799100 8:72698673-72698695 AGTTCTCTATTCTGCTCAGTTGG - Intronic
1042868326 8:73375432-73375454 TTTTCCCTCCTCTACTCTGAAGG + Intergenic
1042993740 8:74669748-74669770 TTTTCTATCTTCTCCTCCCTTGG + Intronic
1043003652 8:74791209-74791231 TTTTCTCTCTCGTTCTCTGATGG - Intronic
1043304236 8:78774066-78774088 TTTTCTTTTCTCTGCTCTTTTGG - Intronic
1043412795 8:80016313-80016335 TTTTATCTTTTCTCCTCTGTAGG - Intronic
1044006390 8:86942243-86942265 TTTTCTCTCCTCTTCTCCTTGGG + Intronic
1044113907 8:88310770-88310792 TTTTCTCTCTTCTTGCCTGGGGG - Intronic
1044141927 8:88666367-88666389 TTTTCTCTATTTTGTTCTTTGGG - Intergenic
1044424191 8:92032174-92032196 TTTTTTTTATTCTGCTGTGTTGG - Intronic
1044462897 8:92466927-92466949 TGTTCTCTCTTCTGTGCTCTGGG - Intergenic
1044570418 8:93711783-93711805 TTGTCTCTATTCTGATCTTTGGG + Intronic
1044634997 8:94314038-94314060 GGTTCTCTCTTCTGTTCTATTGG + Intergenic
1044736092 8:95279947-95279969 ATTTCTCCCTTCAGTTCTGTTGG + Intergenic
1045337367 8:101219863-101219885 GGTTCTCTATTCTGTTCTGTTGG - Intergenic
1045391713 8:101721717-101721739 TTTTCTGACTTCTGCACTGGAGG + Intronic
1045589123 8:103573549-103573571 GGTTCTCTATTCTGCTATGTTGG + Intronic
1046837001 8:118813220-118813242 TTTTCTAGCTTCAGCTGTGTTGG - Intergenic
1046979711 8:120323748-120323770 AGTTCTCTCTTCTGCTCCATTGG + Intronic
1047005032 8:120611281-120611303 TTCTCCCTCTTCTGCACTCTTGG - Intronic
1047281648 8:123451152-123451174 TTTTCTCCCTTATCTTCTGTTGG + Intronic
1047382091 8:124372896-124372918 TTTTCCCTATTCCGATCTGTAGG - Intergenic
1047559674 8:125973067-125973089 TTTGCTCTCTCTTGCTCTCTTGG - Intergenic
1047600924 8:126425293-126425315 TTGTCTATCTTCTTCTCTTTTGG + Intergenic
1048249172 8:132845025-132845047 TTTTCTCTCTTCTTCTCTCAAGG - Intronic
1048273700 8:133049713-133049735 ACTTATCTCTTCTGCTCTCTGGG - Intronic
1048317975 8:133375839-133375861 ATCTCTCTCTTCTTCTTTGTGGG + Intergenic
1048400986 8:134070458-134070480 TTCTCTCTCTTCTGAACTCTTGG + Intergenic
1048622546 8:136150484-136150506 TTTTCTCTCTTCTCTTCTTCAGG + Intergenic
1048645340 8:136413612-136413634 TTCTCTCTCTTCTGCCAAGTGGG + Intergenic
1048703815 8:137126538-137126560 AGTTCTCTATTCTGTTCTGTTGG + Intergenic
1050254234 9:3777407-3777429 CTTTCTCCCTTCTCCTCTTTGGG - Intergenic
1050321253 9:4454698-4454720 TTTGCCCTCTTCTGGTCTATGGG + Intergenic
1050596249 9:7207191-7207213 TTTGCCATCTTCTGCTCTGATGG + Intergenic
1050771714 9:9209350-9209372 ATTTCCCTCTTCTGATCTCTAGG - Intronic
1051035726 9:12742603-12742625 AGGTCTCTGTTCTGCTCTGTTGG + Intergenic
1051861191 9:21627010-21627032 TTTTCTGTTTGCTTCTCTGTGGG - Intergenic
1052216964 9:25978294-25978316 TTTTCTCTCTGCTGATCTTCTGG + Intergenic
1052369595 9:27648729-27648751 TTTTCTCTTTTCTTCTTTATTGG - Intergenic
1052634736 9:31087540-31087562 GGTTCTCTATTCTGTTCTGTTGG + Intergenic
1053354229 9:37432862-37432884 CCTTCTCTCTTCTGCTTTGTGGG + Intronic
1053441528 9:38120414-38120436 TTTTCTCCCTGCTGCTCTAGAGG + Intergenic
1053526533 9:38835609-38835631 TATTATGTCTTCTGCCCTGTAGG + Intergenic
1053614910 9:39754781-39754803 TTTTCTCTCATCCTCTCTGATGG - Intergenic
1053682036 9:40491991-40492013 TTTTCTCCCTCCCGCTCTCTTGG - Intergenic
1053702939 9:40717891-40717913 GTCTTTCTCTTTTGCTCTGTTGG + Intergenic
1054198759 9:62060034-62060056 TATTATGTCTTCTGCCCTGTAGG + Intergenic
1054238607 9:62587609-62587631 TTTTCTCTCATCCTCTCTGATGG + Intergenic
1054281677 9:63132941-63132963 TTTTCTCCCTCCCGCTCTCTTGG + Intergenic
1054393153 9:64631994-64632016 TTTTCTCCCTCCCGCTCTCTTGG - Intergenic
1054412999 9:64841353-64841375 GTCTTTCTCTTTTGCTCTGTTGG + Intergenic
1054427802 9:65137204-65137226 TTTTCTCCCTCCCGCTCTCTTGG - Intergenic
1054502574 9:65884334-65884356 TTTTCTCCCTCCCGCTCTCTTGG + Intronic
1054552738 9:66622131-66622153 TTTTCTCTCATCCTCTCTGATGG + Intergenic
1054639596 9:67528331-67528353 TATTATGTCTTCTGCCCTGTAGG - Intergenic
1055283736 9:74705264-74705286 TGTTCTCTATTCTGTTCTGTTGG - Intergenic
1055358143 9:75459441-75459463 CTCTCTGGCTTCTGCTCTGTAGG + Intergenic
1055371717 9:75606803-75606825 TTTTCTCTCTTCTGCTTTCTTGG + Intergenic
1055407172 9:75987306-75987328 TTTTCCCTCCTCTGGTCTCTTGG + Intronic
1055414510 9:76065981-76066003 TGTTCTCTATTCTGTTCTGTTGG + Intronic
1055644984 9:78354923-78354945 TTCTCTCCCTTATCCTCTGTGGG + Intergenic
1055648194 9:78380540-78380562 TTTCTTCTCATCTTCTCTGTGGG + Intergenic
1056027636 9:82515924-82515946 TGTTCTTTCATCTGCTTTGTTGG + Intergenic
1056280192 9:85034359-85034381 TTTTGTCATTTCTGTTCTGTTGG + Intergenic
1056662076 9:88551250-88551272 TTTTCTGTCTTCTGTTTGGTTGG + Intronic
1057102863 9:92379756-92379778 TTTTCTCTCTTCTGCTCTGTAGG - Exonic
1057940377 9:99276845-99276867 TTGTCTGTCTTCTGATTTGTTGG - Intergenic
1058702861 9:107615070-107615092 GTTTCTCTCTTCCTCTGTGTGGG - Intergenic
1059915741 9:119097818-119097840 TTATCTCTATTCTGTTCTGCTGG + Intergenic
1060266160 9:122112554-122112576 TTTCCTCTCGTCTGCTCTTTAGG - Intergenic
1060535089 9:124379649-124379671 GTTTCACTCTTCTGCTTTTTCGG + Intronic
1060583658 9:124772340-124772362 TTTGCCCACTTCTGCTCTGCCGG + Intergenic
1060744710 9:126123596-126123618 TCTCCTCTCTTATGCTGTGTGGG - Intergenic
1060759336 9:126234829-126234851 ATTTCTCTCTTCTGCGCTTGAGG + Intergenic
1060987852 9:127830030-127830052 TTTTCTCTCTTCAGATTTGCCGG - Intronic
1062251595 9:135598884-135598906 TTTTATCCTTTCAGCTCTGTAGG - Intergenic
1185954589 X:4475653-4475675 TTTTCTCTTTTCTCCTTTCTTGG - Intergenic
1186070290 X:5812190-5812212 TTTTCTCTCTTCTACACTAATGG - Intergenic
1186155295 X:6719139-6719161 TTTATTCTCTTATGCTCTGGAGG + Intergenic
1186638434 X:11429650-11429672 TCTCCTTTCTTCTGCTTTGTAGG + Intronic
1187372005 X:18717167-18717189 TATTCTTTCATCTTCTCTGTAGG - Intronic
1187578747 X:20586129-20586151 TTATCTATTATCTGCTCTGTAGG - Intergenic
1187709407 X:22038883-22038905 TTGCCTATCTTCTGGTCTGTGGG + Intronic
1188045193 X:25417733-25417755 AGTTCTCTATTCTGTTCTGTTGG + Intergenic
1188608686 X:32068589-32068611 TGTTCTCTATTCTGTTCTATTGG + Intronic
1188633472 X:32398901-32398923 TGTTCTCTATTCTGTTCTATTGG - Intronic
1188639031 X:32475186-32475208 GGTTCTCTATTCTGTTCTGTTGG + Intronic
1189806243 X:44738177-44738199 TTTTCCCTCTTCTTTACTGTTGG + Intergenic
1189847738 X:45151958-45151980 TTTATTCTCTCCTGCCCTGTTGG + Exonic
1190027136 X:46934925-46934947 TGGTCTCTCTTTTGTTCTGTTGG + Intronic
1190503053 X:51098050-51098072 TTTTCTTCCTTCTGCTCTGCAGG - Intergenic
1190900871 X:54672043-54672065 ATTGCTCTCTTCTGCGCTGATGG - Intergenic
1191045566 X:56132604-56132626 TTTTCTTTCTTCTCTTCTGCTGG - Intergenic
1191674726 X:63783096-63783118 TTTTCTCTCTCATACACTGTTGG + Intronic
1191795902 X:65020906-65020928 TTTTCTCTTTTGAGCTTTGTTGG - Intronic
1191894560 X:65978355-65978377 GTTTCTCTATTCTGCTCCATTGG + Intergenic
1191930142 X:66363431-66363453 TTTTTTATGTTCTGTTCTGTTGG + Intergenic
1191970654 X:66811964-66811986 GGTTCTCTATTCTGCTCTATTGG + Intergenic
1192913213 X:75627388-75627410 TGTTCTCTCTTCTGTTCCATTGG + Intergenic
1193313554 X:80037794-80037816 TTTTCTTTGATCTGGTCTGTTGG + Intergenic
1193364026 X:80608882-80608904 TCCTTTCTCTTCTTCTCTGTAGG - Intergenic
1193401130 X:81043957-81043979 TGTTCTCAATTCTGTTCTGTTGG + Intergenic
1193412862 X:81184957-81184979 GTTTCTCTATTCTGCTCCATTGG + Intronic
1193491682 X:82157851-82157873 TGTTCTCTATTCTGCTCCATTGG + Intergenic
1193583917 X:83297104-83297126 TTTTCTGTCTTCTGTTTTCTTGG - Intergenic
1193589281 X:83367417-83367439 TGGTCTCTGTTCTGCTCTATTGG + Intergenic
1193664271 X:84297097-84297119 AGTTCTCTATTCTGTTCTGTTGG - Intergenic
1193664434 X:84298868-84298890 GATTCTCTATTCTGTTCTGTTGG + Intergenic
1193690009 X:84630061-84630083 TTATCTCTATTCTGTTCTTTGGG - Intergenic
1193695645 X:84704473-84704495 TTTGGTTTCTTCTGGTCTGTTGG + Intergenic
1194007938 X:88520498-88520520 TTTTCTCTTTTCTTCTTTATTGG - Intergenic
1194014330 X:88600514-88600536 TGTTCTCTATTCTTTTCTGTTGG + Intergenic
1194028073 X:88778737-88778759 GGTTCTCTCTTCTGTTCTATTGG + Intergenic
1194046920 X:89019013-89019035 TGTTCTCTATTCTGTTCTATTGG - Intergenic
1194170170 X:90571373-90571395 TTTTCTCTCTTCTGTTACGCAGG - Intergenic
1194522132 X:94931957-94931979 TTTTCTCTCTTCTCCTCAAGTGG + Intergenic
1194573046 X:95575887-95575909 TTTTCTCTGATATCCTCTGTGGG + Intergenic
1194941739 X:100018355-100018377 TTTTTTTTCTTTTCCTCTGTTGG - Intergenic
1195316466 X:103683994-103684016 TTTTCTCTCTTCTGAAAAGTAGG - Intronic
1195323378 X:103739102-103739124 TTTCCCTTCATCTGCTCTGTGGG + Intergenic
1195409484 X:104554479-104554501 TCTTTTCTCTTCTTCTTTGTTGG + Intergenic
1195477554 X:105303874-105303896 TTTCCATTCTTCTGATCTGTTGG - Intronic
1195541821 X:106070646-106070668 TTTTCTCTCTCTTGCTCTCTTGG - Intergenic
1195612111 X:106879354-106879376 TGTTCTCTATTCTGTTCTATTGG - Intronic
1195682352 X:107557854-107557876 TACTCTCTATTCTGATCTGTTGG + Intronic
1195739679 X:108050940-108050962 GTTTCTTTCTTCTGCTGGGTGGG - Intronic
1195815569 X:108882503-108882525 TTTTCTTTCTTCTGCTGGTTTGG - Intergenic
1196055565 X:111351276-111351298 TCTTCTCTCTTCTGGCCTCTGGG + Intronic
1196193530 X:112818025-112818047 GTGTCTCTTTTCTGCTTTGTGGG + Intronic
1196391776 X:115214555-115214577 TTTTCTCTCTGCTGCACTTATGG - Intronic
1196517126 X:116627464-116627486 TTTTTTCTATTCTTGTCTGTAGG + Intergenic
1196552253 X:117043047-117043069 ATCTCTTTCTTATGCTCTGTGGG - Intergenic
1196672561 X:118384509-118384531 TATTCTCTATTCTGTTCTATTGG + Intronic
1196897563 X:120352724-120352746 TCTTCTCTTTTCTGCTTAGTGGG - Intergenic
1196943815 X:120804415-120804437 TTTTCTAAACTCTGCTCTGTAGG + Intergenic
1197109947 X:122760839-122760861 ATTTCTCTATTCTGTTCCGTTGG - Intergenic
1197251443 X:124220195-124220217 TTTTCTTTCTTCTTTTCTGCAGG + Intronic
1197436964 X:126441694-126441716 TTTTCTTTCTTGCGCTCTGGAGG + Intergenic
1197455358 X:126671738-126671760 TTTTCTCTATTCTTGTCTGCCGG - Intergenic
1197671110 X:129278782-129278804 GGTTCTCTATTCTGATCTGTTGG + Intergenic
1197680501 X:129378267-129378289 TTTTATCTGTTCTTTTCTGTTGG - Intergenic
1197835377 X:130688726-130688748 TTTCCTGTCTTCTGTTCTCTAGG + Intronic
1198130086 X:133685344-133685366 TTCTCTCTCTTCTGCTGGGTTGG - Intronic
1198796054 X:140396227-140396249 GTTTCTCTATTCTGCTCCATTGG - Intergenic
1198894649 X:141439505-141439527 GGTTCTCTGTTCTGTTCTGTTGG + Intergenic
1199107836 X:143892393-143892415 TTTCTTTTCTTCTGCTCTCTTGG - Intergenic
1199424665 X:147687002-147687024 GATTCTCTATTCTGTTCTGTTGG - Intergenic
1199588910 X:149447455-149447477 GGTTCTCTATTCTGTTCTGTTGG + Intergenic
1199911031 X:152287233-152287255 CTATCTCTCTTCTTATCTGTAGG - Intronic
1200315292 X:155126283-155126305 ATTTCTGTCTTCAGTTCTGTGGG - Intronic
1200516414 Y:4149140-4149162 TTTTCTCTCTTCTGTTACGCAGG - Intergenic
1201054661 Y:9976479-9976501 TTCTCTCTCTCCTGTTCTGCTGG - Intergenic
1201375154 Y:13311227-13311249 TGTTTTCTGTTCTGCTCAGTTGG - Intronic
1201550589 Y:15212999-15213021 ATTTTTCTTTTCTGCACTGTAGG + Intergenic
1201594525 Y:15652774-15652796 TTTGCTCTTTTATGCTCTTTTGG - Intergenic
1202191722 Y:22252972-22252994 ATTTCTCTCTCCTGTTCTGCTGG + Intergenic