ID: 1057102865

View in Genome Browser
Species Human (GRCh38)
Location 9:92379796-92379818
Sequence CCGAAGCCTGCATTTTTTTG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 125}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057102863_1057102865 17 Left 1057102863 9:92379756-92379778 CCTACAGAGCAGAAGAGAGAAAA 0: 1
1: 0
2: 5
3: 98
4: 857
Right 1057102865 9:92379796-92379818 CCGAAGCCTGCATTTTTTTGTGG 0: 1
1: 0
2: 0
3: 9
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057102865 Original CRISPR CCGAAGCCTGCATTTTTTTG TGG Exonic
901011900 1:6206879-6206901 CCGAAGCCTGCAACTTCTGGCGG - Intronic
902441114 1:16430670-16430692 CAGAAGCCAGCATTGTTTTTGGG + Intronic
902744098 1:18461682-18461704 CCAGAGCCTGCCTTTGTTTGTGG + Intergenic
903960925 1:27057402-27057424 CTGGAGCCTGCACTTTTGTGTGG + Intergenic
910944248 1:92571800-92571822 CAGAAACCTGCATTTTCTTGAGG + Intronic
912183061 1:107241678-107241700 CCAATGACTGCATTTTCTTGAGG - Intronic
913243601 1:116852064-116852086 CCAAAGCCTGCATTCTTTCCAGG - Intergenic
913966356 1:143380617-143380639 CTGTAAGCTGCATTTTTTTGAGG + Intergenic
914060729 1:144206224-144206246 CTGTAAGCTGCATTTTTTTGAGG + Intergenic
914118421 1:144760145-144760167 CTGTAAGCTGCATTTTTTTGAGG - Intergenic
919658870 1:200223713-200223735 CCAAAGCCTGGACTTTCTTGTGG - Intergenic
923533693 1:234831668-234831690 ACTATGCCTGCTTTTTTTTGGGG - Intergenic
924749937 1:246877272-246877294 TTGAAGCCTGGAATTTTTTGCGG - Exonic
1064725286 10:18272923-18272945 CAGAGATCTGCATTTTTTTGGGG - Intronic
1066090530 10:32014433-32014455 TCGGAGCCTGCTTTTTTTTCCGG - Intronic
1066118809 10:32263767-32263789 ACGAACCCTGCTTTTTTTTCTGG + Intergenic
1067940806 10:50654080-50654102 CCAGATCCTCCATTTTTTTGTGG + Intergenic
1072102073 10:92239197-92239219 CCGAAGCCTCCAGTTCTTTAGGG - Intronic
1079054489 11:17194010-17194032 CCAAAGCCTGCATCTTCTTTAGG - Intronic
1080591837 11:33731202-33731224 CCTAACCCTGCATTGTTTTAGGG + Intronic
1080841453 11:35987215-35987237 CTGAAGTCTGCATATTTTTAGGG + Intronic
1081536579 11:44001154-44001176 CGGAAGCCTGCAGTCTTGTGGGG + Intergenic
1083810558 11:65103275-65103297 CCATTGCCTGCATTTTGTTGGGG - Intronic
1088344230 11:108804757-108804779 CCGAAGCCTTCACTTTTTGCTGG + Intronic
1089099576 11:115951136-115951158 AGGAAGCCTGCCTTGTTTTGAGG + Intergenic
1089101981 11:115970669-115970691 CCGAATCCAGTATTTTATTGAGG - Intergenic
1089106297 11:116008631-116008653 CCGAATCCAGTATTTTATTGAGG - Intergenic
1091658354 12:2362422-2362444 CTGAATCCTACATGTTTTTGTGG + Intronic
1095724987 12:45441849-45441871 CCAAAGCCTGTATTTCTTTAGGG - Intergenic
1096110288 12:49024731-49024753 CCTTAGCCTGAGTTTTTTTGGGG + Intronic
1097640471 12:62174655-62174677 CCCAAGACAGCATTATTTTGAGG - Intronic
1098509000 12:71289998-71290020 CAGAAATCTGCATTTCTTTGGGG + Intronic
1103783195 12:123413203-123413225 CCGCACCCGGCTTTTTTTTGGGG - Exonic
1107461913 13:40612264-40612286 GGGAAGCCTGGATTTTGTTGGGG - Intronic
1109170365 13:59088721-59088743 CCAAGGCCTCCATTTTTTTCTGG - Intergenic
1113162894 13:107402667-107402689 CCAAAGCCTGTATTTTTCAGTGG - Intronic
1113709964 13:112456740-112456762 CAGAACCCTGCATTGATTTGGGG - Intergenic
1113874614 13:113586189-113586211 GCGAATCCTGCATTTCTTGGGGG + Intronic
1118307700 14:64669099-64669121 GCAATGCCTGCATGTTTTTGTGG + Intergenic
1119085872 14:71738430-71738452 CCGGTGCCTGCATGTGTTTGGGG + Intronic
1120081212 14:80218674-80218696 CCAAACACTGCATTTTGTTGAGG - Intronic
1120551285 14:85876290-85876312 CAGAATCATGCATTGTTTTGAGG - Intergenic
1122941087 14:104981721-104981743 CCGCAGCCTGCCTGTTTGTGGGG - Intergenic
1126743558 15:51802082-51802104 CCTCAGCCTGCATCTTTTTTTGG - Intronic
1127867863 15:63046645-63046667 TCGAAGACTCCATTTTTTTCTGG + Intronic
1128373657 15:67059734-67059756 CCTAAGCCTGCATGTTTTAGGGG + Intergenic
1129719711 15:77871459-77871481 CCGGAGCCTTCATTTTTTCCTGG - Intergenic
1130572736 15:85062929-85062951 CCAAAGCCAGAATTTTTATGAGG - Intronic
1132112015 15:99108466-99108488 CCCAAGCCTGTAATTTTTTTCGG + Intronic
1144052817 17:11511575-11511597 CTGAACCAGGCATTTTTTTGGGG - Intronic
1150907995 17:69359122-69359144 GTGAAGGCTACATTTTTTTGCGG - Intergenic
1151139266 17:71976087-71976109 CCCAAGCCTGCAGTTTCATGCGG + Intergenic
1153075328 18:1156115-1156137 CTGAAGCCAGCAATTCTTTGGGG + Intergenic
1154933177 18:21022157-21022179 CTATAGCCTACATTTTTTTGTGG - Intronic
1155558571 18:27049968-27049990 CCGGAGCCTGCACTTTGTTGAGG - Intronic
1157195603 18:45617938-45617960 CCTAAGCCTTCATTTTTCTAGGG - Intronic
1163250120 19:16121883-16121905 CCGAAGCCTAGATGTTTCTGTGG + Intronic
1163404345 19:17113041-17113063 GGGAAGCCAGCATTTGTTTGAGG + Intronic
1164032331 19:21418804-21418826 CAGGAGCATGCTTTTTTTTGTGG + Intronic
1165677087 19:37735749-37735771 CAGAAACCTGGATATTTTTGAGG + Intergenic
1167237202 19:48322145-48322167 CCGAAGCCTGCGGTTTCCTGTGG + Intronic
1202700137 1_KI270712v1_random:158112-158134 CTGTAAGCTGCATTTTTTTGAGG + Intergenic
925092946 2:1169645-1169667 CCGGAGCCTGCAGGTTTTAGTGG - Intronic
925404034 2:3594488-3594510 CCGAATCTTGCATGTTTTGGGGG - Intergenic
928819785 2:35346482-35346504 CAGAAGACTGAATATTTTTGGGG + Intergenic
931104543 2:59040940-59040962 CAAAAGCCTGCATTATTTTCTGG + Intergenic
932791636 2:74658593-74658615 CCCAAGCCTGCCTGTGTTTGAGG - Intronic
933875826 2:86621342-86621364 CCAAAGCCATCATTTTTTTATGG - Intronic
934171070 2:89541587-89541609 CTGTAAGCTGCATTTTTTTGAGG + Intergenic
934281375 2:91615905-91615927 CTGTAAGCTGCATTTTTTTGAGG + Intergenic
935167556 2:100582446-100582468 CCGCACCCGGCCTTTTTTTGGGG - Intergenic
941118832 2:161504989-161505011 TTGAAGCCTGGAATTTTTTGCGG - Intronic
942127406 2:172841058-172841080 CCATAGCATGCATTTTTCTGGGG - Intronic
943675204 2:190710424-190710446 CCTAGGCCAGCATTTTTTTCAGG + Intergenic
946377167 2:219318475-219318497 CCAACGCCTGTATTTTTTTTGGG + Intergenic
1170773185 20:19351982-19352004 CCGGAGCCTGTGTTTTATTGAGG + Intronic
1172562427 20:35901123-35901145 CCTAAGCATGCTTTTTATTGAGG - Intronic
1173068107 20:39734066-39734088 CCATAGTCTGCATTTCTTTGTGG - Intergenic
1173723463 20:45280133-45280155 CCTGAGCCTCAATTTTTTTGAGG + Intergenic
1173745951 20:45437175-45437197 CCCAAGCCTACATTATCTTGTGG - Intergenic
1175357476 20:58380335-58380357 CCGAAGCCGGGTTTTTTTTTTGG + Intergenic
1179008486 21:37534713-37534735 ATGATGCCTGCATTTGTTTGAGG + Intergenic
949578208 3:5359670-5359692 CCCAAGCATGACTTTTTTTGTGG + Intergenic
950716269 3:14849851-14849873 CAGAAGCCAGCATTTTTTTTAGG - Intronic
951084491 3:18495196-18495218 TGGATGCCTGCATTTTTCTGAGG - Intergenic
953050528 3:39338173-39338195 CAGAAGCCTACACTTTTTTGAGG - Intergenic
955813041 3:62811419-62811441 CCAATGCATGCATTTTCTTGAGG - Intronic
958028083 3:88072750-88072772 CTGATGCTTTCATTTTTTTGTGG - Intronic
958562175 3:95760191-95760213 CTGCAGCCTGCTTTTCTTTGTGG + Intergenic
959301728 3:104610996-104611018 CCTAAGCCCACGTTTTTTTGTGG + Intergenic
960260295 3:115560250-115560272 TGGAAGCCTGCATCTTTTGGGGG + Intergenic
964200048 3:154108846-154108868 CCCATGCCTCCATTTCTTTGTGG - Intergenic
965900889 3:173640236-173640258 CTGAAGCCTGTATTTTAATGAGG + Intronic
968072734 3:195796723-195796745 TCTTAGCCTGCATTTTTTTGTGG - Intronic
968380216 4:88176-88198 CCAAAGTCTGCATTTATTTGCGG - Exonic
970862924 4:20723970-20723992 TCAAAGCCTTCATTTTTATGGGG + Intronic
975016396 4:69425941-69425963 CCTTAGCCTACATTTTGTTGGGG + Intergenic
981029139 4:140106442-140106464 CAGAAGCATGCATTTGTGTGTGG + Intronic
982521319 4:156419907-156419929 CAGAAACCTGCATCTTTTTAGGG - Intergenic
990353451 5:54941423-54941445 CTGAAATCTGCTTTTTTTTGAGG - Intergenic
996482506 5:123990869-123990891 CCAAACCCTGCTTTTTTTTTAGG - Intergenic
998586510 5:143432740-143432762 TGGAAGCCTTCATTTTTATGAGG + Intronic
1000180014 5:158799773-158799795 GCTAGGCCTGCATTTTTATGGGG - Intronic
1000750760 5:165093822-165093844 CAGAAGTCTGCATTTTCTTGAGG - Intergenic
1002976431 6:2082453-2082475 CCCATGCCTGCAATTTTATGAGG - Intronic
1008176642 6:48276119-48276141 CTGAAGCATGCATTTACTTGTGG - Intergenic
1008406256 6:51121722-51121744 CCGAATACTGCACTTTTCTGAGG + Intergenic
1016996200 6:149963908-149963930 CCTAGGCATGCACTTTTTTGGGG - Intergenic
1018884944 6:167927462-167927484 CTAAATCCTGCATTTCTTTGTGG - Intronic
1021632290 7:22659228-22659250 ACGAATCCTTGATTTTTTTGGGG - Intergenic
1027125967 7:75556936-75556958 CCACACCCTGCACTTTTTTGGGG - Intronic
1031784874 7:126016851-126016873 CCAAAGAATGCATTTTATTGAGG - Intergenic
1032574618 7:133040132-133040154 TCTAAGTCTGCATGTTTTTGAGG - Intronic
1033518666 7:142137160-142137182 CAGAAGCTTGTATTTTTATGTGG + Intronic
1034064987 7:148127504-148127526 CCGCTGCCTGCACATTTTTGTGG - Intronic
1035556317 8:569658-569680 CAGAAGCCTACATTATTTTAAGG + Intergenic
1037391220 8:18393791-18393813 CCAAATCCTGAATTTTTTTCTGG - Intronic
1039555747 8:38473670-38473692 CTGGAGCCTGCATATCTTTGTGG + Intergenic
1040984286 8:53277021-53277043 CCCAAGTCTGTATTTGTTTGGGG + Intergenic
1045286655 8:100797427-100797449 CCGAAGCGTTCATGTTTTTAAGG + Intergenic
1047347736 8:124044760-124044782 CCGAAGACTGGAGTTGTTTGCGG - Intronic
1047550888 8:125871175-125871197 TTGAACCCTGCATTTTTCTGAGG + Intergenic
1047758960 8:127939968-127939990 CTGAACCCTGCATTTTGTGGAGG + Intergenic
1048932239 8:139324393-139324415 CCAAAGCCTGCATTTAGATGAGG + Intergenic
1055434344 9:76277273-76277295 CTGAAGCCTTCATTCTTTGGGGG - Intronic
1056508166 9:87277157-87277179 CTGGGGCCTGCATTTTTTTGTGG - Intergenic
1057102865 9:92379796-92379818 CCGAAGCCTGCATTTTTTTGTGG + Exonic
1061543492 9:131290588-131290610 CCGGAGCCTGCCTGTTTCTGGGG - Intronic
1062232653 9:135490744-135490766 CAGGAACCTGCATTTCTTTGTGG + Intergenic
1203699250 Un_GL000214v1:122470-122492 CCACATCCTGCGTTTTTTTGGGG - Intergenic
1186190845 X:7066291-7066313 ACGAGGCATGGATTTTTTTGAGG + Intronic
1186498782 X:10033907-10033929 CCAAAGTCTGCATTTTCTTAAGG + Intronic
1190408344 X:50110125-50110147 CCGTAGCCTCCAAATTTTTGAGG - Intergenic
1195475118 X:105276613-105276635 CTGAAGTCTGGATTTTTGTGTGG + Intronic
1198839556 X:140841738-140841760 CTGATGCCTGCTTTTTTTGGGGG + Intergenic