ID: 1057110306

View in Genome Browser
Species Human (GRCh38)
Location 9:92463579-92463601
Sequence CAGCCTACAGGGCTGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 469
Summary {0: 1, 1: 0, 2: 2, 3: 52, 4: 414}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057110306 Original CRISPR CAGCCTACAGGGCTGGAGGA GGG (reversed) Intronic
900124312 1:1062760-1062782 CAGCCTCCAGAGCTGAGGGAAGG - Intergenic
900205935 1:1431945-1431967 CAGCTTACAGGCCTGGGGGCAGG - Intergenic
900390021 1:2429742-2429764 GAGACCACAGGGCTGGAGAAAGG + Intronic
901082045 1:6589033-6589055 CCGCCTGCAGAGCTGGAGGTGGG + Exonic
901195407 1:7437302-7437324 CAGCCTCCAGGGTGGCAGGATGG - Intronic
901735730 1:11310990-11311012 AAGCCTGCATGGCGGGAGGAGGG + Intergenic
901787777 1:11636074-11636096 CTGCCAACCAGGCTGGAGGATGG - Intergenic
902388408 1:16088937-16088959 AAGCCAACAGGGCAGGAGGAGGG + Intergenic
902520590 1:17013439-17013461 CAGCCTCCAGGGCAGCAGGAAGG + Intergenic
902733789 1:18386769-18386791 CAGACAATGGGGCTGGAGGAAGG + Intergenic
903158900 1:21470552-21470574 CTGCCTACAGGGCAGGAGCCAGG - Intronic
904489616 1:30850317-30850339 CAGCCTGCGGTGCTGGAGGAGGG - Intergenic
904615325 1:31746428-31746450 AAGGCTCCAGGGCTGGGGGAGGG - Intronic
904802627 1:33105526-33105548 CATCTTACATGGCTGCAGGAGGG + Intronic
905611771 1:39358765-39358787 CAGCCTGCAGGCCTGGATGCAGG + Exonic
905631794 1:39522920-39522942 GGCCCTGCAGGGCTGGAGGATGG + Intronic
905665969 1:39763267-39763289 GGCCCTGCAGGGCTGGAGGATGG - Intronic
905734153 1:40314796-40314818 CAGACTGCAGGGCAGGAGAACGG + Intronic
905887210 1:41497790-41497812 CAGCAAACAGGGCTGGAGCATGG + Intergenic
906061574 1:42952560-42952582 CAGCACACAGGGCTGTGGGATGG + Intronic
906147770 1:43570076-43570098 CAGGCTACAGGGAAGGAGGAGGG - Intronic
906673987 1:47679975-47679997 CAGCCTTGAGGGGTGGTGGAGGG - Intergenic
906719225 1:47993657-47993679 CAGCCTCCAGGGCCTCAGGAAGG + Intronic
907303462 1:53501961-53501983 CACCCTAGAAGGGTGGAGGAAGG + Intergenic
907715631 1:56923484-56923506 TAGGCTACAGGGATGGAGCATGG - Intergenic
909542152 1:76803223-76803245 CAGCCTCCAGGGAGGGAAGAGGG - Intergenic
910025616 1:82647516-82647538 CATCACACAGGGCTGGAGGCGGG - Intergenic
910221007 1:84889421-84889443 CATCCCACAGGTCAGGAGGAGGG - Intronic
910270011 1:85384427-85384449 CAGGCCACAGAGGTGGAGGAGGG - Intronic
910427643 1:87132447-87132469 CCGCCTCCAGGGGTGAAGGACGG - Intronic
911181494 1:94864451-94864473 CACCCTAAAGGGTTGGTGGATGG + Intronic
912495030 1:110086012-110086034 CAGCCTTCTGGGCTGGGGCAGGG + Intergenic
913302552 1:117387796-117387818 CAGTCTACAGGCCTGGAAGAGGG - Intronic
913543332 1:119842593-119842615 CTGCCTACAGGGCAGGAGCCAGG + Intergenic
913602821 1:120438464-120438486 CTGCCTACAGGGCAGGAGCCAGG - Intergenic
913603569 1:120444817-120444839 CTGCCTACAGGGCAGGAGCCAGG - Intergenic
913656597 1:120966336-120966358 CTGCCTGCAGGGCAGGAGGCAGG - Intergenic
914007734 1:143747592-143747614 CTGCCTGCAGGGCAGGAGGCAGG - Intergenic
914278051 1:146142810-146142832 CTGCCTACAGGGCAGGAGCCAGG + Intronic
914363995 1:146962080-146962102 CTGCCTACAGGGCAGGAGCCAGG - Intronic
914381584 1:147121233-147121255 CTGCCTACAGGGCAGGAGCCAGG + Intergenic
914487684 1:148125059-148125081 CTGCCTACAGGGCAGGAGCCAGG + Intronic
914539098 1:148593758-148593780 CTGCCTACAGGGCAGGAGCCAGG + Intronic
914587260 1:149073928-149073950 CTGCCTACAGGGCAGGAGCCAGG + Intronic
914588035 1:149080213-149080235 CTGCCTACAGGGCAGGAGCCAGG + Intronic
914627580 1:149477865-149477887 CTGCCTACAGGGCAGGAGCCAGG - Intergenic
914646560 1:149658073-149658095 CTGCCTGCAGGGCAGGAGGCAGG - Intergenic
915129825 1:153688525-153688547 GAGCCTACAGGGCAGGAGGCGGG - Intronic
915311340 1:155007305-155007327 CAGCCTAGAGGGCAGGGGGCAGG - Intronic
915627723 1:157125790-157125812 GAGCTTTCAGAGCTGGAGGATGG - Exonic
916906616 1:169292588-169292610 CAGGATATAAGGCTGGAGGAGGG + Intronic
918129050 1:181608908-181608930 GAGCCTACAGGGCTGGGGCAGGG + Intronic
919240954 1:194915024-194915046 CAGTCTTCAGGGCTGTAGGCTGG + Intergenic
919879989 1:201894991-201895013 GGCCCTAGAGGGCTGGAGGAAGG + Intergenic
919922431 1:202174512-202174534 AAGCCTTCAGGGCAGGAGGCTGG - Intergenic
920005740 1:202832572-202832594 CAGCCTCCATGTCTGGGGGATGG + Intergenic
921174643 1:212583538-212583560 AGGCCTACAGGGCAAGAGGAGGG + Intronic
921187583 1:212683550-212683572 CTGCCTGCTGGGCTGAAGGAAGG - Intergenic
921218025 1:212953202-212953224 CCGCATACATGGTTGGAGGAAGG - Intronic
922095614 1:222440604-222440626 CAGGCTACAGTGTAGGAGGATGG - Intergenic
922346378 1:224699996-224700018 CCGCCTACTGGACTGTAGGAAGG + Intronic
922582819 1:226711376-226711398 CACCCTCTAGGGCTGGAGGCAGG - Intronic
923199058 1:231694243-231694265 CAGCCTGCAGCGATGGAGCAAGG + Exonic
923548164 1:234939990-234940012 CTGCCGCCAGGGCTGGTGGATGG - Intergenic
923596346 1:235363093-235363115 CAGCCTACATGCCTGGAGCTGGG + Intergenic
923631084 1:235649891-235649913 CAGCGTCCAGGGCCGGGGGAGGG - Exonic
924197610 1:241624327-241624349 CAGTCTGCATGGCTGGAGCATGG - Intronic
1062960857 10:1572910-1572932 CTGCCTACAGTGCTGCAGTAGGG - Intronic
1063187080 10:3661054-3661076 CAGCCTACAGGGAAGGGGGAAGG - Intergenic
1065258805 10:23903151-23903173 AAACCTAAAGGGATGGAGGAGGG - Intronic
1066192663 10:33070110-33070132 CTGGCTACAGGGCTGAAGTAGGG + Intergenic
1066638998 10:37536814-37536836 CAGCATACTGAGCTGGAGGTGGG - Intergenic
1067051814 10:43025994-43026016 CAGCCTACCAGGAGGGAGGAAGG + Intergenic
1067471583 10:46541921-46541943 AAGCCTCCTGGGCTGGGGGAAGG - Intergenic
1069554577 10:69389431-69389453 CAGAGTTCAGGGCTGGACGAAGG + Intronic
1069711103 10:70489166-70489188 CAGCCTACGTGGGTGGAGGATGG + Intronic
1069777036 10:70933290-70933312 CAGCCTTCAGGCCTGGGGGCTGG - Intergenic
1069822363 10:71235668-71235690 CAGTCCTCAGGGCTGGAGGCTGG - Intronic
1069959379 10:72070588-72070610 CACCCTTCTGAGCTGGAGGAGGG - Intronic
1072430748 10:95368814-95368836 CAGCCAAAAGGGCTGGAGGATGG - Intronic
1073347663 10:102796442-102796464 CTGTCTACAGGGCTAGAGGCTGG - Intronic
1073479687 10:103778716-103778738 AAGCAGAAAGGGCTGGAGGAGGG - Intronic
1074190322 10:111129859-111129881 CAGCCCTCTGGCCTGGAGGATGG + Intergenic
1074522750 10:114239889-114239911 CCGGGTACAGGGGTGGAGGAGGG + Intronic
1074598582 10:114889968-114889990 CAGCCTCCAGGGATGGGGCAAGG - Intronic
1075010250 10:118862494-118862516 TAGCTTTCAGGGCTGGGGGAGGG - Intergenic
1075038320 10:119087742-119087764 CAGACTACAGAGTGGGAGGAGGG - Intergenic
1076015489 10:127024300-127024322 CAGTGTTCATGGCTGGAGGAAGG + Intronic
1076273439 10:129176194-129176216 GAGCCCACTGGGCTGGAGGATGG + Intergenic
1076429493 10:130391641-130391663 CAGCCTGCAGGGCTCATGGAGGG + Intergenic
1076491143 10:130862355-130862377 CAGCGCCCAGGGCTGGAGGGAGG - Intergenic
1076616556 10:131759052-131759074 GAGTCTCCAGGGCTGGGGGAGGG - Intergenic
1076759503 10:132594814-132594836 CAGCCTGCAGGGCTGGCAGGGGG - Intronic
1076769964 10:132657483-132657505 CAGACTACAGAGCTGGGGGTGGG - Intronic
1077210643 11:1369646-1369668 TACCCTCCAGGGCTGCAGGAAGG + Intergenic
1077384330 11:2261885-2261907 CAGGCTGCAGGGCTGTCGGAGGG - Intergenic
1077412168 11:2408693-2408715 CAGCCTGCGGGGCAGGAGGAGGG + Intronic
1079176204 11:18143644-18143666 GACCCTGGAGGGCTGGAGGAGGG - Intronic
1079411607 11:20192844-20192866 CAGACTAGAGGGGTGGATGAGGG - Intergenic
1080429132 11:32182574-32182596 CAACCATCAGGGCGGGAGGAAGG - Intergenic
1080639195 11:34148929-34148951 CATTCTGCAGGCCTGGAGGAGGG + Intergenic
1081570884 11:44290071-44290093 CAGACCACAGGGCTGGATGCAGG - Intronic
1082779480 11:57275647-57275669 CAGGCTTCTGGGCTGGTGGAAGG - Intergenic
1082785858 11:57316219-57316241 CAGCCTCCAGGACTGGGGGAGGG - Intronic
1082938724 11:58680886-58680908 CAAAATACAGGGATGGAGGAAGG + Intronic
1083476619 11:62919610-62919632 ATGCCTACAAGGATGGAGGAGGG - Intronic
1083789720 11:64976719-64976741 CAGCCTCCAAGGCTGAGGGAAGG + Intergenic
1083993999 11:66263257-66263279 CAGGCACCAAGGCTGGAGGAGGG + Intronic
1084313304 11:68329319-68329341 CAGCCCACAGGGCAGCTGGAAGG - Intronic
1084543744 11:69803353-69803375 CAGATTGCAGGGCTGAAGGAAGG - Intergenic
1084952664 11:72675214-72675236 CAGACTACAGGCATGGGGGAAGG + Intergenic
1085654107 11:78296817-78296839 CAGTCCACAGTGCTGGAGGCTGG + Intronic
1085678613 11:78549326-78549348 CAGGCTCCAGTGCTGGCGGAAGG - Intronic
1085750651 11:79158080-79158102 CAGCCCAGAGTGCAGGAGGAGGG - Intronic
1089456014 11:118626211-118626233 AAGCCTGCAGGGCTGGGTGAGGG - Intronic
1089605225 11:119637854-119637876 CAGGGTACAGAGCTGGAGGTGGG + Intronic
1089666762 11:120025604-120025626 CACTCTACAGGGATGGGGGAAGG + Intergenic
1089743213 11:120599368-120599390 GAGGCTCCAGGGATGGAGGAGGG + Intronic
1089923396 11:122231602-122231624 CTGCCTATAGGTCTGGAGCAGGG - Intergenic
1090752520 11:129759996-129760018 CAGTCTTCAGGGCTGGGAGATGG - Intergenic
1091310270 11:134569450-134569472 GAGCTCACAGCGCTGGAGGAGGG + Intergenic
1091917506 12:4280501-4280523 CCGCCCCCAGGGCTGCAGGAAGG - Intronic
1092317872 12:7439070-7439092 CAGGACACAGGGCTGGAGCATGG - Intronic
1092523009 12:9292601-9292623 CATCCCACAGCGCTGGAGGCTGG + Intergenic
1092544282 12:9439296-9439318 CATCCCACAGCGCTGGAGGCTGG - Intergenic
1094508665 12:31082771-31082793 CATCCCACAGCGCTGGAGGCTGG + Intronic
1095506611 12:42905471-42905493 CAGCCTTCAGGGTGGGAGGCGGG + Intergenic
1097251968 12:57639523-57639545 CAGCCTAGAGGGCTGGGGACAGG + Intergenic
1097261574 12:57723489-57723511 CAGCCAGCAGGGCTGCAGGGAGG + Intergenic
1098311935 12:69157195-69157217 GAGGCTGCAAGGCTGGAGGAGGG - Intergenic
1099013167 12:77316013-77316035 CTCCCTACAGGGCTGAATGAGGG + Intergenic
1100113386 12:91272627-91272649 CTGCCAACAGGGCTGGGAGATGG + Intergenic
1101337056 12:103806007-103806029 CAGTCTGGAGGACTGGAGGAAGG - Intronic
1101557190 12:105821440-105821462 CAGCCTAGAGGAGTGGAGGAAGG - Intergenic
1101922880 12:108947175-108947197 CAGACTCCAGGGCTGGGGCAAGG - Intronic
1102950645 12:117028514-117028536 CGGCCTGCAGGGCTGGAGCTGGG - Exonic
1103081191 12:118025227-118025249 CAGCTTCCAGGGGAGGAGGATGG - Intronic
1104031657 12:125069290-125069312 AAGCCTGCAGGGCGGGAGCAAGG - Intronic
1104852469 12:131883883-131883905 CAGCCTACATCCTTGGAGGATGG - Intergenic
1105758802 13:23494416-23494438 CAGCAGACAGGGCTGGAGAAAGG - Intergenic
1106220691 13:27744123-27744145 CATCTTACATGGCTGGAGAAGGG - Intergenic
1107125165 13:36838613-36838635 AAGCCTCCAGCTCTGGAGGATGG - Intergenic
1108081220 13:46738211-46738233 CAGCTCAGAGTGCTGGAGGAAGG + Intronic
1108264443 13:48691035-48691057 CAGCTTGCAGGTCTGGATGAGGG + Intronic
1109016356 13:57020484-57020506 CAGCTGCCAGGGATGGAGGAGGG - Intergenic
1110257721 13:73450639-73450661 CAGCCTTCAAGGCAGGAGAAGGG - Intergenic
1110766007 13:79280010-79280032 CGGCCTACATGGTTGGAGCAGGG - Intergenic
1112109242 13:96276251-96276273 CAGAAGACAGGGCTGGAGGGAGG - Intronic
1113368919 13:109705261-109705283 AAGCCCACAGGGCTGCAGAACGG + Intergenic
1113539449 13:111095052-111095074 CTGCCTACAGGGCTGGCAGGAGG + Intergenic
1113740935 13:112711972-112711994 CAGACAACAGGGCTGGGAGAAGG - Intronic
1113923051 13:113925163-113925185 CAGCCTTCAGGGCGGTAGGTGGG - Intergenic
1113929041 13:113956836-113956858 CATCCTGCAGGGCGAGAGGAGGG + Intergenic
1115395613 14:32905179-32905201 CAGCCTGCAGGCCTGGAAGAGGG - Intergenic
1115746383 14:36442099-36442121 TTGCCTCCAGGGCTGGGGGAGGG + Intergenic
1116157507 14:41225815-41225837 AAGCTTGGAGGGCTGGAGGAGGG + Intergenic
1118166970 14:63346351-63346373 CAGCATTGAGGGCTGGGGGAAGG - Intergenic
1119851182 14:77867713-77867735 CAGGGTACAGGCCTGCAGGAGGG - Intronic
1120216386 14:81684955-81684977 CAGCCTAGAGAGGTGGAGGCAGG - Intergenic
1121718905 14:96095773-96095795 GAGCCTTTAGGGTTGGAGGAGGG + Intergenic
1121793933 14:96720313-96720335 CAGCCTGCAGGGGCAGAGGAAGG - Intergenic
1121940435 14:98065004-98065026 CAGCCTGCAGAGCTGGAGAAAGG + Intergenic
1122281048 14:100622575-100622597 CAGTCTACAGGCCGGGAGGCAGG - Intergenic
1122938095 14:104969144-104969166 CTGCCTCCAAGGCTGCAGGAGGG + Intronic
1124650309 15:31469263-31469285 GAGCCTGCAGGGATGGAGGATGG + Intergenic
1126506497 15:49410149-49410171 AAGCCTAAAGGGCTGGAGAGTGG - Intronic
1127853486 15:62935555-62935577 CAGCCTCCAGGGCCAGAGCAGGG - Intergenic
1128495607 15:68196772-68196794 CAGCCTGCTAGGCTGCAGGAAGG + Intronic
1128674262 15:69597103-69597125 CAGCCTCTAGGGCTGAAGCAAGG + Intergenic
1128716699 15:69913869-69913891 CAGCCGACTGGGCTGGAGGTCGG - Intergenic
1129579606 15:76793444-76793466 CAGCCTTCAGGGAGGGAGAAAGG + Intronic
1129681237 15:77659633-77659655 CTGCCTACAGGGGTAGTGGATGG + Intronic
1129685998 15:77686416-77686438 CAGCATGCAGGCCTGGGGGAAGG + Intronic
1129894820 15:79095302-79095324 CAGCCCACAGGGCTGGGAGGTGG - Intergenic
1131424193 15:92332114-92332136 CAGCCTGAAGGGAGGGAGGAGGG - Intergenic
1131975129 15:97936786-97936808 CAGCCTGCAGGGCTGATAGAGGG - Intergenic
1132260862 15:100423780-100423802 CATCTTACATGGCTGGAGTAGGG - Intronic
1132341120 15:101079101-101079123 GTGCCTCCAGGGCTGGAGCACGG + Intergenic
1132648342 16:1009413-1009435 GAGACTCCAGGCCTGGAGGATGG + Intergenic
1133326151 16:4943534-4943556 CAGCCTGCCGGGGTGGGGGAGGG + Intronic
1133523494 16:6581430-6581452 CAGCCAACACAGCTGGGGGAAGG - Intronic
1134065663 16:11226360-11226382 CAGAGTACAGGGCTTGAGAAGGG + Intergenic
1135327843 16:21538616-21538638 CGGCCTAAAGGTCTGGAGGGTGG + Intergenic
1136338196 16:29624641-29624663 CGGCCTAAAGGTCTGGAGGGTGG + Intergenic
1136364779 16:29805031-29805053 CAGCCCACTGGACTGGGGGAGGG + Intronic
1136499820 16:30664600-30664622 CAGACAGCAGGGCTTGAGGAGGG + Intronic
1137716352 16:50600764-50600786 CAGGCCTGAGGGCTGGAGGAAGG + Intronic
1138395101 16:56697997-56698019 CTGCCTACAAGCCAGGAGGATGG - Intronic
1138418954 16:56886869-56886891 CAGCCTCCAGGGCAGGAGAGGGG + Intronic
1139127169 16:64092230-64092252 GAGCCTACAGGGTTGCAGGTAGG + Intergenic
1139290721 16:65855664-65855686 CAGCATGCAGGGCTGGGAGATGG - Intergenic
1139482147 16:67236647-67236669 GGGCCCACAGGGCTGGAGGCGGG + Exonic
1140376516 16:74449325-74449347 CACACCACAGGCCTGGAGGATGG + Intergenic
1141754161 16:85980198-85980220 CAGCCTAGAGGATGGGAGGAAGG + Intergenic
1141997691 16:87645725-87645747 GGGCCTTTAGGGCTGGAGGAAGG + Intronic
1142040925 16:87893554-87893576 CGGCCTAAAGGTCTGGAGGGTGG + Intronic
1142159294 16:88548328-88548350 CAGACCACAGGGCTGGTGGGTGG - Intergenic
1142675645 17:1511679-1511701 GTGCCAACAGGGATGGAGGACGG + Intronic
1143432350 17:6896297-6896319 CAGCCTACAGGGCCAGGGGCAGG - Intronic
1144301028 17:13923178-13923200 CACCCCACAGGGCTGAAGGGTGG + Intergenic
1144624350 17:16837150-16837172 CAGGCTTCAGGGCAGGAGGAAGG + Intergenic
1144882077 17:18435570-18435592 CAGGCTTCAGGGCAGGAGGAAGG - Intergenic
1145126771 17:20307423-20307445 CCACCTACAGGGCAGGAAGAAGG + Intronic
1145150156 17:20508816-20508838 CAGGCTTCAGGGCAGGAGGAAGG + Intergenic
1145281702 17:21472724-21472746 TAGCCTACAGGGCTGGCGATGGG - Intergenic
1146162087 17:30565461-30565483 CAGGCTTCAGGGCAGGAGGAAGG + Intergenic
1146675604 17:34772002-34772024 CAACCTCCAGGGCTGGCTGAGGG - Intergenic
1147359910 17:39923978-39924000 CAGCCCACAGGGCAGGGGCAGGG + Intronic
1147369079 17:39979452-39979474 CACCCTCCAGGGCTGGGGGGTGG - Intergenic
1147406854 17:40218704-40218726 CAGCTTCCAGGGCTATAGGATGG - Intergenic
1147578486 17:41615871-41615893 CAGGCTTCAGGGCAGGAGGAAGG + Intronic
1147951305 17:44109461-44109483 CAGCCTACAGGGCTGGCCCCAGG + Intronic
1148450528 17:47774848-47774870 GAGTCTAAAGGGCTGAAGGAGGG - Intergenic
1148887605 17:50785138-50785160 CAGACAACAGGGCTGGAGTGGGG + Intergenic
1148907863 17:50922757-50922779 CAGCCTCTGGGTCTGGAGGATGG + Intergenic
1149456779 17:56794583-56794605 CAGCCTTGAAGGCTGCAGGAAGG + Intronic
1150549051 17:66192153-66192175 CAGGCTAGAGGGGTGGAGTAGGG - Intergenic
1151040900 17:70860263-70860285 CATCTTACATGGCTGCAGGAGGG + Intergenic
1151336597 17:73443649-73443671 CAGCCTGCAGGGCTCGATGGGGG + Intronic
1151595719 17:75077140-75077162 CAGCCTCCAGGGCAGGACGCTGG - Intergenic
1151796268 17:76347969-76347991 CAGCCTACAGGGTAGGAGTAAGG + Intronic
1151995201 17:77603949-77603971 CAGACTACAGGGGTGGGGGTGGG + Intergenic
1152315089 17:79575443-79575465 CAGCCAGCAGGGCTGGGGGACGG + Intergenic
1152566326 17:81102002-81102024 CTGCCTGCAGGGATGGAGGGCGG + Intronic
1152721331 17:81925150-81925172 CAGCCTTGAGGGCTGGAGGAGGG - Intronic
1152820603 17:82435875-82435897 CGGCCAACAGGGCTGGGGGAGGG + Intronic
1152933600 17:83123249-83123271 CAGCCTGCAGTGCTGGAGGGAGG + Intergenic
1153080766 18:1221951-1221973 CAGCTGACATGGCTGGAGAAAGG + Intergenic
1153526620 18:6001046-6001068 CCTGCCACAGGGCTGGAGGATGG - Intronic
1153656568 18:7288117-7288139 CAGAATACAGGGTTGGAGTAGGG + Intergenic
1154160124 18:11974996-11975018 CAGCCTAGAGGCCTTGAAGAAGG - Intergenic
1158426002 18:57340086-57340108 CAGCCTATTGGGCTTGAAGAAGG + Intergenic
1159149811 18:64506055-64506077 CATCTTACATGGCTGGAGCAGGG - Intergenic
1159953849 18:74505951-74505973 CAGCCTGCAGCCCTGGAGGACGG + Exonic
1160318415 18:77868689-77868711 CTGACTACAAGGCTGGGGGAAGG + Intergenic
1160726243 19:619012-619034 CAGGCGATAGGGCTGGATGACGG + Exonic
1161208286 19:3053600-3053622 CAGGCTGCAGGGGAGGAGGAGGG + Exonic
1161260837 19:3337009-3337031 CTGCCAACAGGGCTGGGGGTGGG + Intergenic
1161482997 19:4519944-4519966 GGGCCTACCGGGCTGCAGGAAGG - Intergenic
1162128716 19:8512678-8512700 CAGCAGCCAGGGCTGGAGCAAGG + Exonic
1162175516 19:8827175-8827197 CTGGATACAGTGCTGGAGGATGG + Intronic
1162297245 19:9821729-9821751 CAGCATACAGGGCTGGAGAGAGG + Intronic
1162381134 19:10332721-10332743 CAGCCTACAGACCTACAGGAAGG - Intronic
1162500834 19:11052734-11052756 CTGTCTGCAGGGCTGGGGGAGGG - Intronic
1164514051 19:28919065-28919087 CACCCCACAGGCATGGAGGATGG - Intergenic
1164855347 19:31516801-31516823 CAGCATCCGGGGCTGGAGGGAGG - Intergenic
1165149966 19:33754358-33754380 CAGCCTAGAGTGCTGTAGCAAGG - Intronic
1166976762 19:46609456-46609478 GAGCCATCCGGGCTGGAGGAGGG - Exonic
1167491969 19:49798294-49798316 CAGCCTCTAGGCCAGGAGGATGG + Intronic
1167600267 19:50450947-50450969 CAGCCCCCAGGGAAGGAGGAAGG - Intronic
1168025049 19:53637818-53637840 CAACCTCCAGGCCTTGAGGAAGG - Intergenic
1202678317 1_KI270711v1_random:27497-27519 CTGCCTACAGGGCAGGAGCCAGG + Intergenic
925260902 2:2527684-2527706 CAGCAGGCAGGGCTGGTGGAGGG - Intergenic
925352743 2:3213029-3213051 CAGCCTAGAGGGCTGAGGAAAGG + Intronic
926836851 2:17032509-17032531 CAGGCACCAGGGCAGGAGGATGG + Intergenic
927218045 2:20680895-20680917 CAGCCTATAGGGCTGCATGCTGG - Intergenic
928709060 2:33984015-33984037 CAGACTACAGTTCTGGAGGCTGG + Intergenic
929226920 2:39520888-39520910 CATCTTACATGGCTGGAGAAGGG + Intergenic
929227181 2:39522746-39522768 CATCTTACATGGCTGGAGAAGGG + Intergenic
930165434 2:48199326-48199348 CAGCCTAAAGGGGTGGAGTCCGG - Intergenic
931828275 2:66024366-66024388 CAACCCACATGGCTAGAGGAAGG - Intergenic
932468645 2:71939815-71939837 CAGCCTGCAGGGCTCTTGGAGGG - Intergenic
932736895 2:74260599-74260621 CTGTCTAAAGGGCTGGTGGATGG - Intronic
934558087 2:95297857-95297879 CAGCCTTCAGGTTTGGGGGAGGG + Intronic
934757343 2:96833226-96833248 CAGCCTCCAGGGAGGGAGCAGGG - Exonic
936267819 2:111023708-111023730 CAGAACACAGGGCTGGAGGAAGG + Intronic
936972526 2:118188835-118188857 CAGACTCCCTGGCTGGAGGAAGG - Intergenic
937306789 2:120876631-120876653 CAGCTGGCAGGGTTGGAGGAGGG + Intronic
941006347 2:160251084-160251106 CAGCTTACAGTTCTGGAGGCTGG - Intronic
944447378 2:199805196-199805218 GAGGCTGCAGGGGTGGAGGATGG - Intronic
945322453 2:208441001-208441023 CAGCCCACAGGCCAGGAGAAGGG + Intronic
946123611 2:217539196-217539218 TAGCCCACATGGCAGGAGGATGG + Intronic
947101622 2:226627329-226627351 CAGCTTTCAGTGGTGGAGGAGGG + Intergenic
948143764 2:235693187-235693209 CAGCCGGCAGGCCTAGAGGAGGG + Intronic
1168971157 20:1931723-1931745 CAGGTTGCAGGGCTGGTGGAGGG + Intronic
1169392705 20:5203308-5203330 CAGCCTTCAGGCCTGGGGAAAGG + Intergenic
1171131071 20:22653233-22653255 CACCCTGCAGGGGTGGAGCAGGG + Intergenic
1172046558 20:32084561-32084583 CAGCCCACAGGGCCAGAGGGTGG + Intronic
1172810503 20:37644264-37644286 CAGACTGCAGGGCAGGAGGGAGG - Intergenic
1172919725 20:38471458-38471480 CAGCCTAGAGGCCATGAGGAGGG - Intergenic
1173182226 20:40814107-40814129 CAGGCTGAAGGGCTGGGGGAAGG - Intergenic
1173366627 20:42391633-42391655 AAGCCTAAAGAGCGGGAGGAAGG + Intronic
1173376036 20:42483902-42483924 GAGCCTGCGGGGCAGGAGGACGG + Intronic
1174400636 20:50273975-50273997 CAGCCAGCAGGGCTGGAGCAGGG - Intergenic
1175230767 20:57471841-57471863 TCCCCTACAGGGCTGCAGGATGG + Intergenic
1175485193 20:59340738-59340760 AAGCCTGCAGGCCTAGAGGAGGG + Intergenic
1175517037 20:59576604-59576626 AAGCCTTCAGTGGTGGAGGAGGG + Intergenic
1175698024 20:61117074-61117096 CAGCCCACAGGGCTGACGGGAGG + Intergenic
1175725881 20:61318030-61318052 GAGACTAAAGGGCTGGAGGGTGG + Intronic
1175940775 20:62536599-62536621 CAGGATACAGGGCTGGAGCCAGG - Intergenic
1176237064 20:64058287-64058309 CAGCCTACGGGGCTGCATTAGGG - Intronic
1176299049 21:5090045-5090067 CAGCCTTCTGGGCTGGAGCATGG - Intergenic
1178791326 21:35702966-35702988 AGGCCTCCAGGGATGGAGGAAGG + Intronic
1179506659 21:41845544-41845566 CAGCCTTGAGGGCTGGAGCCAGG - Intronic
1179588216 21:42387531-42387553 CAGACCTCAGGGCTGGAGGCTGG + Intronic
1179857976 21:44171903-44171925 CAGCCTTCTGGGCTGGAGCATGG + Intergenic
1180151564 21:45950805-45950827 GTGCCAACAGGGCTGGAGGGAGG - Intergenic
1180911362 22:19453123-19453145 CAGCCTTCTGGGATGGGGGAGGG + Intronic
1183067239 22:35371769-35371791 CAGCCTTCAGGGCTGCTGGTAGG - Intergenic
1183698176 22:39434964-39434986 GAGCATCCAGGGCTGGGGGAGGG - Intronic
1184206344 22:43006233-43006255 CAGCCTACAGAACTGTAAGAAGG + Intronic
1184861967 22:47177413-47177435 GAGCCTCCAGCTCTGGAGGACGG - Intergenic
1185181422 22:49365642-49365664 CAGCCTGGAGGGCTGGTGGACGG + Intergenic
1185361977 22:50413824-50413846 CAGGCTACTGGGCTGGGGGCTGG - Intronic
1185376469 22:50484741-50484763 CTGACTACAGGGCATGAGGAGGG - Exonic
949120532 3:378703-378725 CAGTCCACAGGGATGGAGTAGGG - Intronic
949545620 3:5069640-5069662 CATCCTACAGGGATGAATGATGG - Intergenic
949846341 3:8374168-8374190 CAAAATACAGGGATGGAGGAAGG + Intergenic
950342179 3:12257397-12257419 CATCACACAGGGCTGGAGTAGGG + Intergenic
950722149 3:14891144-14891166 GAGCCTGCAGGGCTGGAGGCTGG + Intronic
952279298 3:31907936-31907958 CAGGCTACAGTGTTGGAGGCTGG + Intronic
952447224 3:33393078-33393100 CATCCTAAAGGGCTGGGGGGAGG + Intronic
953334258 3:42080445-42080467 CTGCCTAGAGAGCTGCAGGAAGG - Intronic
954643772 3:52118167-52118189 CATGCTACAAGGCTGGGGGAAGG - Intronic
955146988 3:56329546-56329568 GAGCCTACCTGCCTGGAGGAAGG + Intronic
955631927 3:60983663-60983685 AAGCATACAGATCTGGAGGATGG + Intronic
956121662 3:65972075-65972097 CAGGCTGCCAGGCTGGAGGAAGG - Intronic
956209637 3:66789719-66789741 TAGCTCACAGAGCTGGAGGAGGG + Intergenic
956308669 3:67854705-67854727 CTGCCTACAGGGATGAAGGAAGG - Intergenic
958458309 3:94361175-94361197 CAGCCTACATAGCAGGAGGAAGG + Intergenic
960249841 3:115439637-115439659 CAGCCTACATAGTGGGAGGAGGG + Intergenic
961412212 3:126730599-126730621 CAGCCCTCAGGGATGAAGGAGGG + Exonic
961459905 3:127043558-127043580 CAGCCTGAAAGGCTGGAGGGAGG + Intergenic
961481053 3:127181029-127181051 CAGCCCACAGGCCTGCAGGGAGG + Intergenic
962308892 3:134312240-134312262 CAGACTCCTGGCCTGGAGGAAGG - Intergenic
962434089 3:135348314-135348336 AAGCCTACAGGGCTGGACCGAGG + Intergenic
962712564 3:138100163-138100185 CAGCCTCCAGGGAGGGAAGAGGG + Intronic
963127978 3:141832985-141833007 CAGCTTACAGGGCAGGAGGGAGG - Intergenic
963228705 3:142888752-142888774 GAGGCTGCAGGGGTGGAGGAAGG + Intronic
964198846 3:154094591-154094613 CAGATTCCAGGGCTGGAGGAAGG + Intergenic
966461346 3:180180269-180180291 CACCCTGGAGGGCTTGAGGAAGG + Intergenic
968115000 3:196082349-196082371 CAGGCTACCAGGGTGGAGGAAGG - Intergenic
968233995 3:197021170-197021192 CTGCCCACAGGGCAGGAGAAGGG - Intronic
968545479 4:1195590-1195612 CAGCAAGCAGGGCTGGAGGGTGG + Intronic
968662952 4:1806347-1806369 CAGGCTTCAGGGGTGGAGGCGGG + Intronic
968664424 4:1813349-1813371 CAGCCGGCTGGGCAGGAGGATGG + Exonic
968895789 4:3402405-3402427 CAGGCTTCAGGGAAGGAGGAAGG - Intronic
968957819 4:3728118-3728140 CCGTCTGCAGGCCTGGAGGAGGG + Intergenic
969277192 4:6143925-6143947 CAGTCTCCAGGGCTGGAGCAGGG + Intronic
969705512 4:8789218-8789240 AAGCCCACAGGCCGGGAGGAGGG + Intergenic
969705586 4:8789466-8789488 AGGCCTACAGGCCGGGAGGAGGG + Intergenic
970402571 4:15731867-15731889 GAGGCTGCAGGGCTGGAGGAGGG - Exonic
970645600 4:18117004-18117026 CAGCTTAAAGGGCAGGGGGATGG + Intergenic
970978277 4:22066921-22066943 CAGTCTACAGGTCTGGATCAGGG - Intergenic
975217346 4:71770651-71770673 CAGCCTAGAGCGTAGGAGGAAGG + Intronic
976165904 4:82254373-82254395 CAATCTACAGTGCTGGAGCATGG + Intergenic
976212175 4:82682202-82682224 CAGCCCACAGAGCTGAAGTAGGG + Intronic
981538601 4:145825267-145825289 AAGCCTGCAGAGCTGGAGGAAGG + Intronic
984881073 4:184410404-184410426 CAGCATATGGGGCTGGGGGAAGG - Intronic
985074795 4:186203784-186203806 CAGCCTACAGGTCCTGAGGTCGG - Intronic
985482907 5:128570-128592 CTGCCTGCGGGGCTGGAGGTGGG + Intergenic
985648463 5:1096288-1096310 CAGCCAACATGGCAGGAGGTTGG + Intronic
986165877 5:5271164-5271186 GAGCCTGCAAGGCTGCAGGACGG - Intronic
987486205 5:18530533-18530555 CAGCCTTCAGGGATGAAAGAGGG - Intergenic
988829934 5:34977520-34977542 CATCCTCCAGGGAGGGAGGAGGG - Intergenic
990286971 5:54310245-54310267 CAGCCTCCAGGGCGGGTGGGTGG - Intronic
990654012 5:57934636-57934658 CATCTTACATGGCTGGAGTAGGG - Intergenic
990926167 5:61026236-61026258 CAGCCTGCAGGGGAGGAGGGGGG + Intronic
991897777 5:71423251-71423273 CAGCCCACGGGGCTGGGGGTAGG - Intergenic
991974375 5:72171770-72171792 CACCCTTCAGGTCTGGAAGAGGG + Intronic
992418055 5:76572018-76572040 CAGGGAACAGGGCTGGGGGAGGG - Intronic
992608680 5:78488541-78488563 CAGCCTGCAGATCTGGCGGACGG + Exonic
992889983 5:81195163-81195185 GAGCCCGCAGGCCTGGAGGAGGG - Intronic
992962563 5:81971164-81971186 CAGGGCAAAGGGCTGGAGGAAGG - Intergenic
995374814 5:111462063-111462085 AAGCCAACATGGCTGGAGCATGG - Intronic
995544081 5:113212868-113212890 CAGCTTAAAGAGCTGGAGCAAGG - Intronic
995603407 5:113823854-113823876 AAGACTAGAAGGCTGGAGGAGGG + Intergenic
995767705 5:115636842-115636864 GAGCCTTCTGGGCTGCAGGATGG + Intergenic
996757376 5:126948928-126948950 CGGCCTACAGTGGTGGAGGTGGG + Intronic
997531808 5:134586133-134586155 CAGCCTACATGGCTGCTTGAGGG + Intergenic
998128763 5:139640689-139640711 CAGTGGACAGGGCTGGGGGATGG + Intergenic
998168924 5:139860576-139860598 AAGCCTACAGGGCTGGGCCATGG + Intronic
998387105 5:141763703-141763725 CAGCCTCCCGGGTTGGTGGAGGG - Intergenic
998427266 5:142039567-142039589 CATAAGACAGGGCTGGAGGAGGG - Intergenic
1001382486 5:171313613-171313635 TCACCTGCAGGGCTGGAGGAAGG + Intergenic
1002322106 5:178382422-178382444 CAGCCTCCAGAGGAGGAGGAGGG - Intronic
1005968596 6:30744005-30744027 CAGATTAAAGGGCTCGAGGACGG + Exonic
1006427662 6:33976324-33976346 GGGCCTCCAGAGCTGGAGGAGGG - Intergenic
1006442276 6:34060040-34060062 CAGACTCCAGGGCTGGGGGGTGG + Intronic
1006900873 6:37500062-37500084 CAGCCTAGATGGGTGGAGGGTGG + Intergenic
1006921466 6:37630325-37630347 CAACCAGCTGGGCTGGAGGAAGG - Intergenic
1007345221 6:41223925-41223947 AAGCCTCCAGGCCTGGAGCATGG + Intergenic
1007990164 6:46246819-46246841 CAGCCAACAGGTGGGGAGGAAGG + Exonic
1008127872 6:47689288-47689310 CACCCCTCAGGGTTGGAGGACGG - Intronic
1008359099 6:50593564-50593586 CAGGTTTCAAGGCTGGAGGAAGG + Intergenic
1010252882 6:73726880-73726902 GAGGGCACAGGGCTGGAGGAAGG - Intronic
1011085753 6:83538482-83538504 CAACCATCAGGGCTGGAGGAGGG - Intergenic
1013330414 6:109094909-109094931 CAGCCCAGAGGGCGGGAGCAGGG + Intergenic
1013455629 6:110326876-110326898 CAGCCTCCCGGGGTGGAGCAGGG + Intronic
1013486889 6:110605875-110605897 CAGAGGACAAGGCTGGAGGAAGG + Intergenic
1014089242 6:117384816-117384838 CAGATTAGAGGGCAGGAGGAAGG + Intronic
1017077220 6:150630432-150630454 CAGCCCACAGGGTTTGTGGATGG + Intronic
1017798075 6:157865507-157865529 CAGCCTCCAAGGATGGAGGTGGG + Intronic
1018071584 6:160168553-160168575 CATCCTACTGGGCTGCAGGCAGG - Intergenic
1018247662 6:161838407-161838429 CAGCCTGCAGTGATGGAGGGGGG - Intronic
1018726135 6:166614752-166614774 GAGGTTACAGGGGTGGAGGAAGG - Intronic
1018873905 6:167803666-167803688 GAGCCAACAGGGCTGGGGAATGG - Intergenic
1019129059 6:169860211-169860233 CAGCCGACAGGGAAGGCGGATGG - Intergenic
1019357142 7:586499-586521 CCCCCAACAGGGCTGGAGGGTGG - Intronic
1019713443 7:2527728-2527750 CAGCGTCCAGGCCAGGAGGAAGG - Exonic
1019921897 7:4168464-4168486 CAGCCTCTGGGGCTGGAAGATGG - Intronic
1021414025 7:20361399-20361421 CAGCCTCCAGAGCTGTAAGAAGG - Intronic
1021798383 7:24280460-24280482 CAGGCTACAGTGCAGAAGGAAGG + Intergenic
1022523416 7:31022368-31022390 CAGCCTACAGTTCAGGAGAAAGG + Intergenic
1022532145 7:31073781-31073803 CAGGCTAGAGGGCTGGATGGAGG + Intronic
1022646366 7:32232480-32232502 CAGGCCACTGGGCAGGAGGACGG - Intronic
1023243780 7:38178560-38178582 GAGCCTCCAGGGGAGGAGGAGGG + Intronic
1023528432 7:41129430-41129452 CAGGCTACAGGGATGGAAGGTGG - Intergenic
1024471550 7:49772662-49772684 CAACCAACAGGGCTGGATGGAGG - Intergenic
1024825611 7:53386464-53386486 CAGACCACAGGGCTGGAGCAGGG - Intergenic
1024831258 7:53460696-53460718 TAGCCTAGAGGGTGGGAGGAGGG + Intergenic
1025029693 7:55547117-55547139 AAGCCGACAGAGCTGTAGGAGGG + Intronic
1026338781 7:69417708-69417730 CGATCTTCAGGGCTGGAGGAGGG + Intergenic
1027555935 7:79664882-79664904 CAGAGCACAGGGCTGGAGTATGG - Intergenic
1028190844 7:87849873-87849895 CAACTTACAGGGTAGGAGGAAGG + Exonic
1028522312 7:91745791-91745813 TAGCATAAAGGGCAGGAGGAAGG - Intronic
1029551238 7:101238128-101238150 CAGCCTTCAGTGGTGAAGGACGG + Exonic
1029859181 7:103551101-103551123 AACCATGCAGGGCTGGAGGAGGG - Exonic
1030307194 7:108030909-108030931 CAGCGATCAGGGCTGGAGGATGG - Exonic
1031009694 7:116513005-116513027 CGGCATACAGGGCTGGGGGAGGG - Intergenic
1032513273 7:132488892-132488914 CAGCCAGAAGGGCTGGAGCAAGG + Intronic
1033737816 7:144241119-144241141 AGGCCTACAGGGCTCTAGGATGG + Intergenic
1033745239 7:144309838-144309860 AGGCCTACAGGGCTCTAGGATGG - Intergenic
1034131487 7:148722503-148722525 CAGCCTGGAGGCCTGCAGGATGG - Intronic
1034825166 7:154255593-154255615 CTTCCCACAGGGCAGGAGGAGGG - Intronic
1035216674 7:157372755-157372777 CAGCCTCCAGGACTGGGAGATGG - Intronic
1038439004 8:27558757-27558779 CAGCACCCTGGGCTGGAGGAGGG - Intergenic
1038624929 8:29182501-29182523 CAGCCTAAGGGGGCGGAGGAGGG + Intronic
1039517844 8:38148211-38148233 CAACCAAGAGGGCTGGAAGAAGG - Exonic
1041102960 8:54415146-54415168 CAGACAACACAGCTGGAGGAGGG - Intergenic
1041748783 8:61236912-61236934 CTGCCTACAATGCTGGTGGATGG + Intronic
1042750843 8:72156002-72156024 CATCTTACATGGCTGGAGCAGGG + Intergenic
1043522453 8:81061125-81061147 CAGGCTACTGGGCTGGAAGTCGG + Intronic
1044259281 8:90098547-90098569 CACCCTAGAGGGCTGCAGGAAGG - Intergenic
1044743696 8:95352416-95352438 CCACCTACAGGGCTGGGGAACGG + Intergenic
1047727469 8:127696392-127696414 CAGGCTACATGGCTGGGGAAGGG + Intergenic
1048922832 8:139246478-139246500 CAGCCTAAAGGACTGGAGGTAGG - Intergenic
1049526544 8:143129745-143129767 CAGGCTTCAGGGCTGGGGGAAGG + Intergenic
1050120521 9:2302730-2302752 GAGCCTATAGAGCTGGAGCAAGG - Intergenic
1052904073 9:33818063-33818085 CTGCCTCCAGGGATGGGGGAGGG - Intronic
1052996453 9:34553839-34553861 CAGCCGGCAGGGGCGGAGGAGGG + Intronic
1054824377 9:69557504-69557526 CAGGCAACAGGGCAGCAGGAGGG - Intronic
1055453492 9:76452576-76452598 CATCTTACACGGCTGGAGCAGGG + Intronic
1056715534 9:89025298-89025320 GAGCCTACAAGCCTGGAGGTGGG - Intronic
1057054106 9:91948842-91948864 CACCCTGCGGGGGTGGAGGAGGG - Intronic
1057110306 9:92463579-92463601 CAGCCTACAGGGCTGGAGGAGGG - Intronic
1057566530 9:96170048-96170070 CAGCCCACAGGGCTGCACCAGGG + Intergenic
1061036800 9:128118737-128118759 AAGGGTACAGGGATGGAGGATGG + Intergenic
1061445388 9:130634499-130634521 CAGCTGGCAGGGCTGGGGGAAGG - Intronic
1061998615 9:134204257-134204279 CAGCCCACAGGGCTCCAGGTTGG - Intergenic
1062262697 9:135670830-135670852 CAGGCGAGAGGGCTGGAGGCGGG - Intergenic
1062343547 9:136104338-136104360 CAGGCTGCAGGGGTGGAGGGGGG - Intergenic
1062565917 9:137163958-137163980 CGGCCTTCGGGGATGGAGGAGGG - Intronic
1062681259 9:137782720-137782742 CAGTCAACGGGGCTGGGGGAGGG - Intronic
1186436787 X:9549975-9549997 CAGCCTTCAGCCCAGGAGGATGG + Intronic
1187372926 X:18725539-18725561 CAGACTGCAAGGCTGGAGGGAGG - Intronic
1188822233 X:34789611-34789633 CATCCTACATGGCTGGAGAAGGG - Intergenic
1189293343 X:39901375-39901397 CAGCCTCAAGACCTGGAGGATGG + Intergenic
1189478482 X:41375221-41375243 CAGCCAACTGGGCAGGAGGGTGG - Intergenic
1190462799 X:50695392-50695414 CAGCCTCCATGGCTGTAGTAGGG + Intronic
1191960598 X:66697268-66697290 CAGCCTACATGGTTGGGTGAGGG - Intergenic
1192197393 X:69037803-69037825 CAGCCTAGATGGCAGGAGAAAGG + Intergenic
1192223868 X:69215435-69215457 CAGTCTCCAGGGATGGAGGTGGG - Intergenic
1192584509 X:72308605-72308627 CAGCCTTGAGGGCTGGAGAATGG - Intergenic
1196465491 X:115968490-115968512 CCACCTACGTGGCTGGAGGAGGG - Intergenic
1197461032 X:126741233-126741255 CAGGCTGCAGGGATGGGGGACGG + Intergenic
1198474283 X:136980980-136981002 CAACATAAAGGGATGGAGGAAGG - Intergenic
1199511126 X:148623916-148623938 AAGCCTACAGGGTTGGTAGAAGG + Intronic
1200357524 X:155567717-155567739 CATGCCACAGGGCTGGTGGAAGG - Intronic