ID: 1057112283

View in Genome Browser
Species Human (GRCh38)
Location 9:92484737-92484759
Sequence GACTGAGGAGTGCCTTGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 209}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057112283_1057112289 1 Left 1057112283 9:92484737-92484759 CCCACCCAAGGCACTCCTCAGTC 0: 1
1: 0
2: 0
3: 15
4: 209
Right 1057112289 9:92484761-92484783 AGTTGCCTGCATGGCCTTTCTGG No data
1057112283_1057112290 2 Left 1057112283 9:92484737-92484759 CCCACCCAAGGCACTCCTCAGTC 0: 1
1: 0
2: 0
3: 15
4: 209
Right 1057112290 9:92484762-92484784 GTTGCCTGCATGGCCTTTCTGGG No data
1057112283_1057112288 -8 Left 1057112283 9:92484737-92484759 CCCACCCAAGGCACTCCTCAGTC 0: 1
1: 0
2: 0
3: 15
4: 209
Right 1057112288 9:92484752-92484774 CCTCAGTCGAGTTGCCTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057112283 Original CRISPR GACTGAGGAGTGCCTTGGGT GGG (reversed) Intronic
901529366 1:9843673-9843695 GACTGAGGTGTACCTTGGCTGGG - Intergenic
901664497 1:10818750-10818772 GACTGGGGAGTGCCCCGGGCAGG + Intergenic
901755714 1:11440279-11440301 GACTGAGGAGTCCATGTGGTGGG - Intergenic
902619762 1:17644072-17644094 GAATGAGAAGGGCCATGGGTGGG - Intronic
903672745 1:25046171-25046193 GACAAAGGAGGGCCTGGGGTGGG + Intergenic
904190950 1:28743165-28743187 GGCTGAGGAGACCCCTGGGTTGG - Exonic
905472269 1:38202370-38202392 GTCAGAGGAGAGCCTTGGATTGG + Intergenic
906163607 1:43669431-43669453 GTGTGAGAAGTGCTTTGGGTAGG + Intronic
906212483 1:44019864-44019886 GACTGAGAAGTGCCGGGGATGGG + Intronic
906225506 1:44118596-44118618 GACTGAGGGGTGGAATGGGTCGG + Intergenic
906462613 1:46047676-46047698 GACTGGGGACTGCCTTAGTTGGG - Intronic
907435038 1:54440198-54440220 GAGAGAGGAGTGGCCTGGGTGGG + Intergenic
908557185 1:65267224-65267246 TACTGGGAAGAGCCTTGGGTTGG + Intronic
908788978 1:67762182-67762204 TACTGTGGACAGCCTTGGGTTGG - Intronic
910171024 1:84377211-84377233 ACCTGAGTAGTGCCTTTGGTGGG - Intronic
911065962 1:93788803-93788825 GACTGAGCAGTGACTTGGCATGG - Intronic
912381251 1:109249427-109249449 GGCGGAGGAGTGCTCTGGGTGGG + Intergenic
913227980 1:116717084-116717106 GGCTGAGGAGTGCAGTGGGGTGG + Intergenic
916215463 1:162389747-162389769 GTCACAGGAGTGCTTTGGGTTGG + Intergenic
919878340 1:201886683-201886705 GAGTGAGGAGGGGCTTGGGTGGG - Intergenic
919897572 1:202018662-202018684 GCCTGAGGAGGGGCTGGGGTTGG + Intergenic
920228197 1:204453100-204453122 GACTGAGGAGGGTCCTGGGGAGG - Intronic
922766561 1:228159235-228159257 GGCAGAGGAGTGCCCTGGCTTGG + Exonic
922928816 1:229373104-229373126 GTCTGAGGAGTGCTGTGGGGTGG + Intergenic
923092977 1:230753667-230753689 GACTGAGGAGGGGCCTGGGCTGG - Intronic
924317302 1:242811603-242811625 GAGTTAGGAGGGACTTGGGTTGG - Intergenic
924843675 1:247743242-247743264 CAGAGAGGAGTGCCATGGGTAGG - Intergenic
1063400696 10:5742280-5742302 AATTGAGGAGTCCCTTGGTTTGG + Exonic
1065977282 10:30853527-30853549 GAGGGAAGAGTGTCTTGGGTGGG - Intronic
1066235389 10:33480458-33480480 GGCTGAGGAGTGCCGGGGGACGG - Intergenic
1067150172 10:43725733-43725755 GACTGGGGTGTGCCTTGGTGTGG - Intergenic
1069757725 10:70783290-70783312 GACTGAGGAGGGCTTGGGGTAGG - Intronic
1069880816 10:71591908-71591930 GACTGAGGTGTGGGTTGGTTAGG + Intronic
1070067651 10:73053543-73053565 GGCTGAGGACTGCTTTGAGTTGG - Exonic
1074916277 10:117959002-117959024 TACTGAGGAGTGCATTTGCTAGG - Intergenic
1076075905 10:127533671-127533693 TACTCAGGAGTGCCTGGGGGCGG - Intergenic
1076924541 10:133475792-133475814 GGCTGAGGACTGCCTGGGCTGGG + Intergenic
1077154525 11:1085434-1085456 GGCTGAGGGGTGCCTGGGGTGGG + Intergenic
1077208700 11:1358024-1358046 GACTGAGGAGTGCAGAAGGTTGG - Intergenic
1077896987 11:6460481-6460503 GATTGGGGAGTGCCTCGGATTGG + Intronic
1078084721 11:8226936-8226958 GTCTGGGGAGTGTGTTGGGTCGG + Intronic
1080274876 11:30492770-30492792 GACTGAGGGGTGGCAGGGGTTGG - Intronic
1080929366 11:36792130-36792152 TACTGGGGTGTGCCTGGGGTTGG + Intergenic
1081020775 11:37946255-37946277 GACTGTGGAGCACATTGGGTAGG + Intergenic
1081807603 11:45899017-45899039 GCGTGAGGTGTGCCTTGGGGAGG + Intronic
1083186837 11:61022530-61022552 GACTGTGGGGGGCCCTGGGTGGG - Intergenic
1083212599 11:61197715-61197737 GACTGGGAAGAGCCTGGGGTGGG + Intergenic
1083215548 11:61216875-61216897 GACTGGGAAGAGCCTGGGGTGGG + Intergenic
1083218432 11:61235704-61235726 GACTGGGAAGAGCCTGGGGTGGG + Intergenic
1083324157 11:61865131-61865153 GGCTGAGGAGTGTGTAGGGTGGG - Exonic
1083675847 11:64324236-64324258 GAGTGAGGACGTCCTTGGGTGGG + Intergenic
1083807733 11:65084820-65084842 GACTGAGCAGGGCACTGGGTGGG + Intronic
1084169870 11:67395934-67395956 GACTGAGATGTGCCTTGGAGAGG + Exonic
1084932929 11:72571271-72571293 GACTGAGGGGTGGATTGGTTGGG - Intergenic
1088802458 11:113318717-113318739 GACAGGGGAGTGTCCTGGGTGGG + Intronic
1089015198 11:115159685-115159707 AACTGGGCAGTGCCCTGGGTTGG + Intergenic
1089348409 11:117807044-117807066 GACTGAGAAGTTCCTTGGCCGGG + Intronic
1089492462 11:118892513-118892535 GCCTGGGGAGGGGCTTGGGTAGG + Intronic
1090651964 11:128814919-128814941 CACTAAGCATTGCCTTGGGTTGG - Intergenic
1091399231 12:172464-172486 GAGGGAGGAGTGCGTGGGGTTGG - Intronic
1093656265 12:21697706-21697728 GAAGGAGGAGTGCCATGGGGAGG + Intronic
1100714306 12:97289794-97289816 GAGTAAGAAGTGCCTTGGCTGGG - Intergenic
1102892666 12:116572657-116572679 AACTGAGGCATGCCTTGGCTGGG - Intergenic
1103059585 12:117847796-117847818 CACTCAGAAGTGCCTTGGGACGG - Intronic
1103928292 12:124435698-124435720 GGCTGAGCAGTGCCTGGGGAGGG - Intronic
1105015930 12:132786867-132786889 GCCTGAGCAGTGCCTTTGGTGGG - Intronic
1110854136 13:80278644-80278666 GGCTGAGGAGTGCCCGGGGCAGG - Intergenic
1112430328 13:99345424-99345446 CTCAGAGGAGTGCCTTGGCTGGG + Intronic
1115998239 14:39215490-39215512 GGCTGAGGAGACCCCTGGGTTGG - Intergenic
1117224284 14:53638749-53638771 GGCTGAGGAGAGCTTGGGGTTGG + Intergenic
1118640009 14:67783261-67783283 GAGTGATGAGTCCCTTGGGGAGG + Exonic
1119334460 14:73820865-73820887 TGCTGAGTAGTGACTTGGGTGGG - Intergenic
1120640061 14:86999948-86999970 AACTGAGGGGTGAGTTGGGTTGG - Intergenic
1122398922 14:101455633-101455655 GGCTGAGAAGTGCCTGAGGTTGG + Intergenic
1124365979 15:29071911-29071933 TACTGGGGAGTCCCATGGGTAGG + Intronic
1125768973 15:42152814-42152836 GAGGGAGGAGTGCCTAGGGCAGG + Intronic
1126929539 15:53632510-53632532 CACTAAGCAGTGCCTTAGGTGGG - Intronic
1130335988 15:82957768-82957790 GACTTAGGAGAGCCCTGGATGGG - Intronic
1133130566 16:3673952-3673974 GACTGGGGTGTGCCTGGGGAGGG - Intronic
1137055489 16:35744425-35744447 GACTCAGCAGTGCTTGGGGTTGG + Intergenic
1137685343 16:50382784-50382806 GACTGAGGCTTGGCTTTGGTGGG + Intergenic
1137718959 16:50616452-50616474 GACTGGGAAGTGCCATGGGGAGG - Intronic
1138429934 16:56962211-56962233 GAGAGAGGAGTGCCCTGGGAGGG + Intronic
1140987853 16:80176260-80176282 GACTCAGGAGGGCCTTTTGTTGG - Intergenic
1141677159 16:85523952-85523974 CACTGAGGAACGCCTTGGGGAGG + Intergenic
1142242308 16:88953150-88953172 GAATGAGGAGTGCCGTGCCTGGG + Intronic
1142674493 17:1505372-1505394 GACAGGGTAGGGCCTTGGGTGGG - Intronic
1143270965 17:5674007-5674029 TACTCAAGAGTGCCTTGTGTTGG + Intergenic
1143447862 17:7019517-7019539 GACTGGGGAGTGCCCTGGGGAGG + Intergenic
1143522325 17:7451834-7451856 GAGTGAGGACGTCCTTGGGTGGG - Intronic
1144269955 17:13605929-13605951 GACTGAGGAATACCTAGGGAAGG - Intergenic
1144479177 17:15614850-15614872 AACTTAGGAGTGCCTTGAGGTGG + Intronic
1144874214 17:18388720-18388742 GACTGAGAAGGGCCATTGGTAGG + Intronic
1145158012 17:20555698-20555720 GACTGAGAAGAGCCATTGGTAGG - Intergenic
1147188665 17:38726303-38726325 GACTTAGGAGTGCCGAGGGTGGG + Exonic
1147395078 17:40136249-40136271 AACTGGGGAGTCCCCTGGGTAGG - Intronic
1147775125 17:42895468-42895490 GCCTGAGGAGTGGCTTGCTTGGG + Intergenic
1148676953 17:49451282-49451304 GACTGAGAACTGCATAGGGTAGG - Intronic
1151707069 17:75774725-75774747 GACTGATCAGTGCCTGGGGTGGG + Intergenic
1152029202 17:77831182-77831204 GACTGAGGGCTGCTTTGGCTGGG - Intergenic
1152278622 17:79372406-79372428 GACTGAGGAGAGCCATAGGATGG - Intronic
1152294547 17:79459101-79459123 GGCTGTGGAGTGCCTAGGGGAGG - Intronic
1152758958 17:82098448-82098470 GACTGAGGAGCGCCGGGGGCGGG + Intergenic
1154141287 18:11826580-11826602 CCCTGTGGGGTGCCTTGGGTTGG + Intronic
1158689399 18:59646486-59646508 GACGGATGAGGGTCTTGGGTTGG + Intronic
1159597399 18:70395510-70395532 GACTGAGGAGGCCTTTGGGCAGG + Intergenic
1160106205 18:75979362-75979384 GAATGAGGATTGCCATGGGCTGG - Intergenic
1160776469 19:858864-858886 GTCTCAAGGGTGCCTTGGGTTGG - Intergenic
1162792699 19:13071235-13071257 GTCTGAGGAGGCCCTGGGGTGGG + Intronic
1163137171 19:15320672-15320694 GTCTCAGGAGTTACTTGGGTGGG - Intronic
1165822088 19:38683145-38683167 GACTGGGGAGTGCCTGGGAGGGG + Intronic
1165826779 19:38710122-38710144 GAGTGACGCGTGACTTGGGTGGG - Intronic
1166463141 19:43007510-43007532 GTCTGAAGCGGGCCTTGGGTTGG - Intronic
1168282814 19:55314607-55314629 GACTCAGTAGTCTCTTGGGTGGG - Intronic
1168353214 19:55687957-55687979 GCCTGGGGAGTGGGTTGGGTGGG + Intronic
925465789 2:4106489-4106511 GACTAAGGTCAGCCTTGGGTCGG - Intergenic
925608896 2:5686736-5686758 AACTCAGGAGTGACTCGGGTAGG + Intergenic
926268930 2:11350391-11350413 GACTGAGGAGAGGCTAGGGAAGG - Intergenic
926924870 2:17977166-17977188 GACTGGGTGGTGCCATGGGTAGG - Intronic
928260091 2:29758639-29758661 GCCTGAGCAGTGCCTGGGGAGGG - Intronic
930711795 2:54557236-54557258 GACTGAGGTGAACCTGGGGTGGG + Intronic
936162832 2:110097722-110097744 GAGGGAGGAGTGCCAGGGGTGGG + Intronic
937159322 2:119745482-119745504 CACTGCAGAGTGCCTGGGGTGGG - Intergenic
939663856 2:144925153-144925175 TATTCAGGAGTGCCTTGGCTAGG - Intergenic
944129949 2:196336962-196336984 GAATGAGGAGTGGTTTGCGTAGG + Intronic
947978149 2:234385435-234385457 GCCTTAGGAGTTCCTTGGCTTGG + Intergenic
948855663 2:240729437-240729459 GAATGAGGAGTGCCTGGGCTGGG - Intronic
1168982841 20:2022624-2022646 GACTGAGGGGTGCCCAGAGTGGG + Intergenic
1169150179 20:3283368-3283390 GACTCAGGAGAACCTGGGGTGGG - Intronic
1174287026 20:49481089-49481111 GACTGAGGAAGGCTTGGGGTGGG - Intronic
1175899316 20:62353798-62353820 GACTGAGCAGAGCCTGGGGAGGG - Intronic
1178349045 21:31858347-31858369 GACTCAGAAGTCCCTTGGGAAGG + Intergenic
1180063892 21:45403378-45403400 GACTTAGGAATGGGTTGGGTTGG + Intergenic
1180995752 22:19964451-19964473 GACTGAGGAGGCCCTGTGGTGGG + Intronic
1181747578 22:24966456-24966478 GGCTGGGGAGTGGCTTGGTTAGG + Intronic
1182729443 22:32475158-32475180 GAGTGGGGAGTGCTTGGGGTGGG + Intronic
1183041111 22:35178646-35178668 GAGTCAGCAGTGCCCTGGGTGGG - Intergenic
1183302335 22:37064456-37064478 GACTGAGCAGCGCCATGGGATGG - Intergenic
1184752659 22:46497483-46497505 GCCAGAGGAGTTCCTTGGGTTGG + Intronic
949198238 3:1339225-1339247 GATTGAGGAGGGCATTGAGTGGG - Intronic
950211845 3:11129453-11129475 GAATGGGGGGTGCCTGGGGTTGG + Intergenic
950265873 3:11572511-11572533 GACTGAGGAGGGCCTGGAGCAGG - Intronic
951231105 3:20180572-20180594 GGCTGGGGAGTGGCTGGGGTTGG + Intronic
952356565 3:32590409-32590431 CCTTGAGAAGTGCCTTGGGTAGG + Intergenic
953103359 3:39851965-39851987 GACTGAGGAGAGCCATTTGTGGG + Intronic
953882319 3:46696979-46697001 CACTGAGCAGTGTCCTGGGTTGG + Intergenic
956813248 3:72885447-72885469 CACTTAAGAGGGCCTTGGGTGGG - Intergenic
965232450 3:166071395-166071417 TACTAGGCAGTGCCTTGGGTAGG + Intergenic
966933843 3:184692721-184692743 GAATGAGTAGAGCCTTGGGAAGG + Intergenic
967232739 3:187355983-187356005 GACTGGTGATTGCCTAGGGTTGG + Intergenic
967740384 3:192997256-192997278 GACTCAGCAATGCCTGGGGTTGG - Intergenic
967877624 3:194277657-194277679 GACTGGGGAGTGTCTGGGGAAGG - Intergenic
968291722 3:197544293-197544315 GACTGAGAAGTAACTTGGTTAGG - Intronic
969133370 4:5009862-5009884 GACTTAGGAATGCCTTGAGCTGG + Intergenic
974559583 4:63499510-63499532 GACTGAGAAGAGCATTGGGGAGG + Intergenic
978813766 4:112879520-112879542 GATTCAGGAGTGGCTTGGCTGGG - Intronic
979482914 4:121238798-121238820 AACTGAGGAGTGCCTCGGCCCGG + Intergenic
981610228 4:146585926-146585948 GAATTAGGGGTGCCTTTGGTTGG - Intergenic
983817405 4:172149285-172149307 GACTGAGGAGTCCAGTGTGTAGG - Intronic
985869567 5:2543311-2543333 GACTGTGGAGTGACTTGAGGCGG - Intergenic
985882031 5:2645664-2645686 GAGTGACCAGTGGCTTGGGTTGG + Intergenic
986054596 5:4123745-4123767 GACTGAGCACTGCCTTGTATAGG - Intergenic
988038499 5:25858691-25858713 GCCTGAGGTCTGCCTTGGCTTGG + Intergenic
999179810 5:149661419-149661441 CAAGGAGGAGTGCCATGGGTGGG + Intergenic
999872069 5:155762874-155762896 GAATCAGGAGTACCCTGGGTAGG + Intergenic
1000439626 5:161250081-161250103 GACTCAGGAATGCTTGGGGTTGG - Intergenic
1002282930 5:178143726-178143748 GAGTAAGGAGGCCCTTGGGTGGG + Exonic
1002605358 5:180379899-180379921 GACTGAGGAATGCGTGGGGCTGG + Intergenic
1002609375 5:180404463-180404485 GAATGAGGAACGCCTTTGGTGGG + Intergenic
1003337878 6:5192247-5192269 GACTGAAGATGGCCTGGGGTAGG + Intronic
1003502335 6:6712864-6712886 AGCTGAGGAGAGCCTTGGGGAGG + Intergenic
1005644038 6:27824504-27824526 CACTGAGGAGTGGTTTTGGTAGG + Intergenic
1009938320 6:70259810-70259832 GCCTGCGGAGTGCCTTGGTATGG + Intronic
1012533439 6:100266713-100266735 GGCTGAGGAGTGCCTTCTGCAGG + Intergenic
1012847977 6:104413630-104413652 GAAGGAGGAGGGCTTTGGGTTGG - Intergenic
1013478367 6:110530443-110530465 GACGGAGGAGTACTTTGGGGAGG + Intergenic
1015965728 6:138693542-138693564 GACTGCGGAGCGCCGTGGGCAGG - Intergenic
1017743838 6:157429452-157429474 AACTGATGAGTTCCTTGGGTGGG + Intronic
1017856467 6:158354090-158354112 TCCTGAGGAGTGCCTTTGGAAGG + Intronic
1018469897 6:164085936-164085958 CACTGAGGAGTGACGTGGGCAGG + Intergenic
1018774147 6:166998663-166998685 GGCCGAGGAGGGCGTTGGGTGGG - Intergenic
1018818884 6:167357708-167357730 GAATGAGCCGTGCCTGGGGTGGG + Intronic
1018838244 6:167501075-167501097 GACTGAGGTTTGCCATGGGCGGG - Intergenic
1019661104 7:2224479-2224501 GACTGCGGTGTGCGTTGTGTGGG - Intronic
1022092607 7:27117437-27117459 GACCTAGGAGAGCCTTGGGGTGG - Intronic
1022532716 7:31076857-31076879 GGCTGAGGAGGGGCTAGGGTGGG + Intronic
1022642679 7:32203184-32203206 GACTGAGAAATGCCATGAGTGGG - Intronic
1024404346 7:48961457-48961479 GTCTGAGGAGGGCCTTGGAGAGG + Intergenic
1025986987 7:66462666-66462688 GACAGAGGAGAGGGTTGGGTAGG - Intergenic
1032192628 7:129773388-129773410 CCCTGGGGACTGCCTTGGGTGGG - Intergenic
1032611884 7:133423889-133423911 GGCTGCGGAGTGCCTGGGCTAGG + Intronic
1032854044 7:135819390-135819412 GCCTGTGGAGTGCTTTGGGCAGG - Intergenic
1033718137 7:144024520-144024542 GACAGCTGAGTGGCTTGGGTGGG - Intergenic
1034272965 7:149812222-149812244 GAGTGAGGAGGGGCTTGGCTGGG - Intergenic
1035858715 8:3005206-3005228 GACTGTGCAGTACCCTGGGTGGG + Intronic
1037605953 8:20437266-20437288 AACTGAGGAGTGGCATTGGTAGG + Intergenic
1039269930 8:35869378-35869400 GAAGGAAGAGTGCCTTGGATTGG + Intergenic
1042317014 8:67435562-67435584 GACTTAGGAGTGCCGAGGGTGGG + Intronic
1045542648 8:103101331-103101353 GACTGAGGAGGGCCCTGCTTTGG + Intergenic
1045628659 8:104088156-104088178 CACTGATAAGAGCCTTGGGTAGG + Intronic
1045675014 8:104597901-104597923 GACTGAGGAGTGCCCAGGAGCGG + Intronic
1047205457 8:122799690-122799712 GACTGAGGAGCTCCTGGGCTAGG + Intronic
1048815501 8:138330086-138330108 GAGTGAGGAGTGAGTTGGGGTGG - Intronic
1049184831 8:141244594-141244616 CACTGTGGAGTGCGTTGAGTGGG + Intronic
1049645876 8:143735379-143735401 GAGGGGTGAGTGCCTTGGGTGGG + Intergenic
1049757859 8:144318802-144318824 CTCTGAGGAGGGCCTCGGGTGGG - Intronic
1051231340 9:14958560-14958582 GGCTGGGGAGTGGCTTGGTTGGG - Intergenic
1052399752 9:27985942-27985964 CAGTGAGAAGTGTCTTGGGTTGG - Intronic
1052866083 9:33465421-33465443 CACTGAGGCTGGCCTTGGGTAGG - Intronic
1053016367 9:34664621-34664643 CACAGAGGAGCGACTTGGGTTGG - Exonic
1053387871 9:37709122-37709144 GACGGAGGAGTGCCATTGATAGG + Intronic
1053479896 9:38408489-38408511 GACTCAGGAGCGCCTTGGCTGGG - Intergenic
1056279016 9:85021459-85021481 GTCTGAGGAGTACGTTGGGAAGG - Exonic
1057112283 9:92484737-92484759 GACTGAGGAGTGCCTTGGGTGGG - Intronic
1057319670 9:94000938-94000960 GAGTGAGGAGTACCTGGGTTGGG - Intergenic
1058596796 9:106623562-106623584 TACTCAGGAGGGCTTTGGGTTGG - Intergenic
1059329342 9:113525095-113525117 GACGGAAGAGCCCCTTGGGTTGG + Intronic
1061155979 9:128861861-128861883 GACTGAGGGGTGTCTTGGGATGG + Intronic
1061226737 9:129284839-129284861 GACTGTGGAGGGCCTTTGCTGGG + Intergenic
1061318852 9:129815169-129815191 GAATGAGGAGGAGCTTGGGTTGG - Intronic
1061661948 9:132136269-132136291 GACTGTGAAGTGCCTAGGATGGG + Intergenic
1187284737 X:17894133-17894155 GACTCAGGAGTGACTTGGTTGGG + Intergenic
1190762452 X:53447884-53447906 GACTGAGGAAGGTCTTGAGTGGG - Intergenic
1192331435 X:70178412-70178434 GCCTCAGAAGAGCCTTGGGTGGG - Intronic
1196767663 X:119263094-119263116 GACAGAGGGGTGCTTTTGGTGGG - Intergenic