ID: 1057119637

View in Genome Browser
Species Human (GRCh38)
Location 9:92559475-92559497
Sequence CTGCTCCTGCAGGACCTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 515
Summary {0: 2, 1: 2, 2: 4, 3: 52, 4: 455}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057119637_1057119642 -5 Left 1057119637 9:92559475-92559497 CCTCCCAGGTCCTGCAGGAGCAG 0: 2
1: 2
2: 4
3: 52
4: 455
Right 1057119642 9:92559493-92559515 AGCAGTCCATTTCCCTCAGAGGG No data
1057119637_1057119645 3 Left 1057119637 9:92559475-92559497 CCTCCCAGGTCCTGCAGGAGCAG 0: 2
1: 2
2: 4
3: 52
4: 455
Right 1057119645 9:92559501-92559523 ATTTCCCTCAGAGGGTCTGTGGG No data
1057119637_1057119644 2 Left 1057119637 9:92559475-92559497 CCTCCCAGGTCCTGCAGGAGCAG 0: 2
1: 2
2: 4
3: 52
4: 455
Right 1057119644 9:92559500-92559522 CATTTCCCTCAGAGGGTCTGTGG No data
1057119637_1057119649 13 Left 1057119637 9:92559475-92559497 CCTCCCAGGTCCTGCAGGAGCAG 0: 2
1: 2
2: 4
3: 52
4: 455
Right 1057119649 9:92559511-92559533 GAGGGTCTGTGGGTCCTCTTGGG 0: 57
1: 172
2: 147
3: 115
4: 206
1057119637_1057119641 -6 Left 1057119637 9:92559475-92559497 CCTCCCAGGTCCTGCAGGAGCAG 0: 2
1: 2
2: 4
3: 52
4: 455
Right 1057119641 9:92559492-92559514 GAGCAGTCCATTTCCCTCAGAGG No data
1057119637_1057119648 12 Left 1057119637 9:92559475-92559497 CCTCCCAGGTCCTGCAGGAGCAG 0: 2
1: 2
2: 4
3: 52
4: 455
Right 1057119648 9:92559510-92559532 AGAGGGTCTGTGGGTCCTCTTGG 0: 102
1: 123
2: 96
3: 160
4: 337

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057119637 Original CRISPR CTGCTCCTGCAGGACCTGGG AGG (reversed) Intronic
900159538 1:1216988-1217010 CGGCAGCTGCGGGACCTGGGTGG + Exonic
900229225 1:1547889-1547911 GGACTTCTGCAGGACCTGGGCGG - Intronic
900490351 1:2945900-2945922 CTGCTCCGCCAGGATCTGTGAGG - Intergenic
900572709 1:3366664-3366686 CTGCTCCAGCAAGCCCAGGGTGG - Intronic
900680744 1:3914946-3914968 CTCCAGCTGCAGGAACTGGGAGG - Intergenic
900919741 1:5662690-5662712 CTGCTGCTGGAGGCCCAGGGTGG - Intergenic
901114911 1:6835556-6835578 CTGTTCCAGTAGGTCCTGGGTGG + Intronic
901626318 1:10627191-10627213 CGGCTGCAGGAGGACCTGGGTGG - Intronic
901730218 1:11273539-11273561 CTTCTCCCCCAGGACCTGAGAGG - Exonic
902218850 1:14951928-14951950 CTGGTCCAGCAGCACCTAGGAGG - Intronic
902516546 1:16992567-16992589 CTCTTCCTCCAGGACCTGGCAGG + Exonic
902605882 1:17569167-17569189 CTGCCCCTGGAGGAACTGGTGGG + Intronic
902727733 1:18348404-18348426 CTGCTCTGGCGGGGCCTGGGAGG - Intronic
902733724 1:18386421-18386443 CTGTTTCTGCAGGTCCCGGGTGG - Intergenic
903332189 1:22601850-22601872 CAGCTCCTCCAGCACCTGAGAGG - Exonic
904409878 1:30319058-30319080 CTGCCCCTGAGTGACCTGGGAGG + Intergenic
905540236 1:38754977-38754999 GTGGTCCTGCTGGACCTGTGTGG + Intergenic
905654396 1:39676783-39676805 CCGATCATGCAGGACCTGGAGGG + Intergenic
906024164 1:42658693-42658715 CCGCTTCTGGAGGAACTGGGCGG + Intronic
906197351 1:43937106-43937128 CTGTCCCTACAGGGCCTGGGCGG - Exonic
906484337 1:46222636-46222658 TTGCTCCAGAAGGACCGGGGTGG - Intergenic
908412212 1:63878200-63878222 CTGCCCGTGAAGGACCAGGGAGG + Intronic
909262421 1:73509056-73509078 CTGCTGTTGCAGCACATGGGTGG + Intergenic
909661788 1:78091541-78091563 CTGCTCCTGCAGGATTTCAGCGG + Intronic
909985307 1:82154427-82154449 CTGCTGGTGCAGGGGCTGGGAGG + Intergenic
910458106 1:87419976-87419998 CTGCTCACTCAGGTCCTGGGGGG - Intergenic
911288541 1:96027935-96027957 GTGCTCCTGCAGGAACAGTGTGG - Intergenic
914900226 1:151707634-151707656 CTGCTGCTGCATCAGCTGGGGGG + Exonic
915246189 1:154558133-154558155 TTGCTCTCGAAGGACCTGGGAGG - Intronic
915301518 1:154954206-154954228 CTTCTCCCCCAGGACCTGGAAGG + Intronic
915929236 1:160048504-160048526 CTGCACCTGCTGCCCCTGGGAGG - Intronic
915979605 1:160411513-160411535 CTGCTGCTGGGGGGCCTGGGAGG - Intronic
917534295 1:175863318-175863340 CTCCTCATCCAGAACCTGGGGGG + Intergenic
917944547 1:179955145-179955167 GAGCTCCTGTAGGACCTGGCTGG + Intronic
918771842 1:188571217-188571239 CTTCTCCTGCAAGAACTGGAAGG - Intergenic
918912435 1:190591393-190591415 CAGCTTCAGCAGGACCTGGGAGG - Intergenic
919077990 1:192835928-192835950 CTTCACCTTCAGGACCAGGGAGG - Intergenic
919762794 1:201108795-201108817 CTGAAACTGCAGGGCCTGGGAGG - Intronic
920284913 1:204872380-204872402 CTGCTCCTTCAGACCGTGGGAGG - Intronic
922384873 1:225072919-225072941 ATGCACCTGCAGGACATGGCTGG + Intronic
924279070 1:242417862-242417884 AGGCTCCTGCAGGACCTTGTAGG + Intronic
1063411638 10:5840847-5840869 TTTCTGCAGCAGGACCTGGGTGG - Intronic
1063431995 10:5999267-5999289 CGGTCCTTGCAGGACCTGGGGGG + Intergenic
1063671084 10:8100706-8100728 CTCCTCTTGCAGGACCTAGAGGG + Intergenic
1064147126 10:12834367-12834389 CTGCTCCTGCTGGAGGTGGCGGG - Exonic
1064256609 10:13747753-13747775 GTGCTCCTTCAGGGCTTGGGTGG + Exonic
1066616492 10:37300308-37300330 CTGCTTCTGCAGGGCTGGGGAGG - Intronic
1067008620 10:42690245-42690267 CTTCTCCTGCAGAATCTGGAGGG - Intergenic
1067693993 10:48522572-48522594 CTGCTCGTCCAGGCCCTGGCGGG + Intronic
1068178041 10:53487224-53487246 ATGCTGCTGCAGGGCCTGCGTGG - Intergenic
1068460433 10:57321887-57321909 CTCCACCTGCAGCCCCTGGGCGG + Intergenic
1069566987 10:69470197-69470219 ATGCTCCTGCAGGAAATGTGTGG - Intronic
1069571748 10:69498404-69498426 CTGCTCCTGTGGGGACTGGGGGG + Intronic
1069659096 10:70111790-70111812 CTGCGCCGGCAGGACCTGCCCGG - Exonic
1069837189 10:71316906-71316928 CTTCTCCTCCAGGATCTAGGCGG - Intergenic
1070700434 10:78597985-78598007 CTGATCCTGCAGTGCCCGGGGGG - Intergenic
1070777431 10:79118010-79118032 CTGCAGATGCAGGAACTGGGGGG + Intronic
1071569038 10:86686443-86686465 CAGCCCCTGCAGACCCTGGGAGG + Intronic
1071629153 10:87204113-87204135 CTGCCGCTGCAGCACCGGGGAGG - Intergenic
1071863466 10:89700274-89700296 TTGATTGTGCAGGACCTGGGAGG + Intergenic
1072688072 10:97550498-97550520 CAGCTCCTGCAGCAGCAGGGAGG - Intronic
1072806074 10:98424710-98424732 GTGCTGCTGCAGAAGCTGGGAGG + Intronic
1072818710 10:98535344-98535366 CTGCTCCTTCAGGAATTGGTAGG - Intronic
1073488273 10:103835613-103835635 CTTCTCCTGGAGGCCCAGGGGGG + Intronic
1073732384 10:106305301-106305323 CTGCTCCTCTAGTACCTGGTCGG + Intergenic
1074192613 10:111150744-111150766 CTACTCCTGCAGCCCCTGGGTGG + Intergenic
1074964241 10:118474560-118474582 CTGATCCTGTAGGTCTTGGGTGG + Intergenic
1075315197 10:121447678-121447700 CTGCTACTAGAGGAACTGGGGGG - Intergenic
1075578740 10:123599830-123599852 CTGCTCCTGCAAGTCCTGGTGGG - Intergenic
1075608609 10:123834192-123834214 CTGCTCCTGGACGTCCTGTGGGG - Intronic
1075643084 10:124079497-124079519 GTCCTGATGCAGGACCTGGGAGG + Intronic
1075703488 10:124484273-124484295 TTGCTCCTTCAGGATCTGGCAGG - Exonic
1075995326 10:126872224-126872246 AAGCTCATGCAGGCCCTGGGGGG + Intergenic
1076809525 10:132879381-132879403 CTGCTCCTGCAGCACCTCCCGGG - Intronic
1076824087 10:132958534-132958556 CTGCTCCTGCAGGGCGCCGGTGG + Intergenic
1076947966 10:133664898-133664920 CGGCTCCTGGAGCGCCTGGGAGG - Intergenic
1076948956 10:133668208-133668230 CGGCTCCTGGAGCGCCTGGGAGG - Intronic
1076949940 10:133671507-133671529 CGGCTCCTGGAGCGCCTGGGAGG - Exonic
1076950924 10:133674806-133674828 CGGCTCCTGGAGCGCCTGGGAGG - Intergenic
1076951914 10:133678116-133678138 CGGCTCCTGGAGCGCCTGGGAGG - Intergenic
1076952903 10:133681426-133681448 CGGCTCCTGGAGCGCCTGGGAGG - Intergenic
1076953887 10:133684725-133684747 CGGCTCCTGGAGCGCCTGGGAGG - Intergenic
1076954871 10:133741077-133741099 CGGCTCCTGGAGCGCCTGGGAGG - Intergenic
1076955860 10:133744387-133744409 CGGCTCCTGGAGCGCCTGGGAGG - Intergenic
1076956850 10:133747697-133747719 CGGCTCCTGGAGCGCCTGGGAGG - Intergenic
1076957837 10:133751006-133751028 CGGCTCCTGGAGCGCCTGGGAGG - Intergenic
1076958822 10:133754305-133754327 CGGCTCCTGGAGCGCCTGGGAGG - Intergenic
1076959811 10:133757615-133757637 CGGCTCCTGGAGCGCCTGGGAGG - Intergenic
1076960795 10:133760914-133760936 CGGCTCCTGGAGCGCCTGGGAGG - Intergenic
1076983591 11:219113-219135 CTGCTCCTCCAAGGCCTCGGTGG - Intronic
1077227620 11:1445241-1445263 CAGCTCCGGCCGGGCCTGGGCGG - Intronic
1077442702 11:2576058-2576080 CTCCTCCTGGATCACCTGGGTGG - Intronic
1077783214 11:5354667-5354689 CTGCAGGTCCAGGACCTGGGAGG - Intronic
1077922946 11:6655412-6655434 CTGGGCCTGCGGGACCCGGGCGG - Intronic
1078363893 11:10691342-10691364 CTGCTCCTCCAGGAGGTGTGGGG + Intronic
1079097910 11:17522801-17522823 CTGCTCCTGGAGGATCTTGTTGG + Exonic
1079690031 11:23406338-23406360 CTGCCCCTGCTGGACCAGGTGGG - Intergenic
1080586011 11:33683183-33683205 TTGCTCCTGCAGGGCCTGGGAGG - Intergenic
1080919017 11:36690042-36690064 CTGGTCCTGCAGGTCTAGGGTGG + Intergenic
1083061317 11:59875552-59875574 GTGCTGCTGTAGGAGCTGGGGGG - Intergenic
1083234940 11:61345331-61345353 CTGCTCCTGGAGAAGATGGGAGG + Exonic
1083764244 11:64834467-64834489 CCGCTCCTGCAGGCCCTGCTTGG + Exonic
1083883033 11:65557844-65557866 CTGCTGCTGCTGGGCCTGGGCGG - Exonic
1084364658 11:68689919-68689941 CTGCTGCAGTAGGACCTGTGTGG - Intronic
1084534204 11:69747141-69747163 CTGCTCCCACAGGGCCTGTGGGG + Intergenic
1084733018 11:71086777-71086799 CTGCTCCTGCAGGCCCGTGCAGG + Intronic
1085278073 11:75312648-75312670 ATTATCCTGCATGACCTGGGTGG + Intronic
1085400790 11:76234385-76234407 CTGCGCCTTCAGGAGCTGGCTGG - Intergenic
1089059170 11:115612191-115612213 CAGCTCCAGCAGGTCTTGGGGGG + Intergenic
1089620803 11:119721189-119721211 CTTCTCCGGGAGGAGCTGGGTGG - Intronic
1090404014 11:126466501-126466523 CTGCACCTGCAGGACAGGGCGGG + Intronic
1090417150 11:126548432-126548454 CAGCTCCTGTAGGGCATGGGTGG - Intronic
1091322686 11:134663213-134663235 CTGTCCCTGCAGGGCCTGAGAGG + Intergenic
1091402529 12:189535-189557 TTTCTCCTGCAGCCCCTGGGCGG + Intergenic
1091475650 12:769596-769618 TTGCTGCTGCAGGACTGGGGTGG - Intronic
1091900873 12:4142919-4142941 CTCCACCTGGAGGACCTGGGTGG + Intergenic
1092249414 12:6884301-6884323 CTTGGCCTGCAGGGCCTGGGTGG - Intronic
1094499365 12:31008601-31008623 ATGCTGCTGCTGGTCCTGGGTGG - Intergenic
1095966006 12:47867589-47867611 CTACTCCTGCTGGGGCTGGGAGG - Intronic
1096384857 12:51188593-51188615 CTGGCACTGCAGGGCCTGGGAGG + Exonic
1096956724 12:55534136-55534158 CTGCTCATGAAGGACCCAGGAGG + Intergenic
1096977726 12:55708820-55708842 CTGGCTCAGCAGGACCTGGGTGG + Intronic
1097889035 12:64759179-64759201 CTGCTACTGCTGGTGCTGGGCGG - Exonic
1100802510 12:98248146-98248168 TTGTACCTGCAGGACTTGGGTGG - Intergenic
1101798769 12:108002320-108002342 CTGATCCTGTAGGACCTTGAGGG - Intergenic
1102016265 12:109649916-109649938 CTGCTCCACCAGGTCGTGGGAGG + Intergenic
1104223245 12:126806578-126806600 ATGCTCCTGTAGTACTTGGGAGG + Intergenic
1104405169 12:128510992-128511014 GTCCTCCAGCAGGACCTGGAAGG - Intronic
1104864016 12:131942091-131942113 CTGCTCCTGCAGCAGCTGTGTGG - Intronic
1106169037 13:27272879-27272901 CTGCTTCTGCAGAAGCTGGGTGG + Intronic
1106183031 13:27384352-27384374 CAGATCCTTCAGGACCCGGGGGG - Intergenic
1106776731 13:33016501-33016523 CTGGTGCTGCTGGGCCTGGGCGG + Exonic
1107295065 13:38899445-38899467 CTGTCCCTGGAGGGCCTGGGAGG - Intergenic
1107821029 13:44285843-44285865 CAGTTCATGCAGGACCTGAGGGG - Intergenic
1111691057 13:91563871-91563893 CTCCTCCCGGAGGACCGGGGAGG + Intronic
1112760046 13:102684805-102684827 ATGCTCCTGAAGAACCTGGTGGG - Intergenic
1113196534 13:107814357-107814379 CTTCTCTTCCAGGACCTGGATGG - Intronic
1113587427 13:111474893-111474915 CTGCTGCTGAGGGACCGGGGAGG + Intergenic
1113741895 13:112716777-112716799 CAGCTCCTGCAGGGCCCAGGTGG + Intronic
1113835839 13:113328048-113328070 CTGCGCCGGCTGGGCCTGGGAGG - Intronic
1114524735 14:23360472-23360494 CACCTGCTGCAGGCCCTGGGTGG + Intronic
1117247683 14:53902034-53902056 CTGATTCTGCAGGTCTTGGGTGG - Intergenic
1117373766 14:55102319-55102341 GCCCTCCTGCAGGCCCTGGGTGG - Intergenic
1118287314 14:64487643-64487665 GTGCTCCTCCAGGGCCTGGGTGG + Exonic
1118351094 14:64972653-64972675 CTGCATCTGCAGGATCTGGCCGG + Intronic
1118596701 14:67441233-67441255 CTGATCCTCCAGGTCCTGTGAGG + Intergenic
1118878990 14:69810307-69810329 CTCCTCCTGCTGTCCCTGGGTGG + Intergenic
1119285735 14:73452727-73452749 CTGCTTCTGCAGCTCTTGGGAGG - Intronic
1119665019 14:76479303-76479325 CTGCTCAGCCTGGACCTGGGAGG + Intronic
1121337702 14:93087307-93087329 ATGTTCCTGCATTACCTGGGTGG - Intronic
1122029962 14:98905070-98905092 CTGCTCCCTCAGGTGCTGGGTGG + Intergenic
1122292814 14:100688588-100688610 TTGCCTCTGCAGGACTTGGGTGG + Intergenic
1122986425 14:105213777-105213799 CTACTCCTGCAGAACCCGGCTGG + Intronic
1202852703 14_GL000225v1_random:31123-31145 CGGATCCTGGAGCACCTGGGTGG - Intergenic
1202854875 14_GL000225v1_random:43859-43881 CGGCTCCTGGAGATCCTGGGAGG - Intergenic
1202856330 14_GL000225v1_random:53881-53903 CGGCTCCTGGAGCGCCTGGGAGG - Intergenic
1202857286 14_GL000225v1_random:59148-59170 CGGCTCCTGGAGCTCCTGGGAGG - Intergenic
1202858075 14_GL000225v1_random:63863-63885 CGGCTCCTGGAGGGCCTGGAAGG + Intergenic
1202859382 14_GL000225v1_random:72150-72172 CAGCTCCTGTAGCGCCTGGGAGG + Intergenic
1202860542 14_GL000225v1_random:78981-79003 CGGCTCCTGGAGCACCTGGGAGG + Intergenic
1123783057 15:23645802-23645824 CTGCTCCAGCTGGACCAAGGGGG + Exonic
1124103305 15:26715095-26715117 CAGCTCCTTGAGGACCTGGGGGG + Intronic
1124602572 15:31147619-31147641 CTGCTCCTGCAGTCCCCAGGCGG + Intronic
1124649469 15:31464390-31464412 GTGCTCCTGCTGGTCCTGGGAGG + Intergenic
1125506322 15:40269802-40269824 CTGCTGCTGCAGGTGCTGGCTGG - Intronic
1125511371 15:40294126-40294148 TTGCTACTGCAGGAACTGGCTGG + Intronic
1125530083 15:40407334-40407356 CAGCTCCTGCAGGGCCTAGTAGG + Intronic
1126185799 15:45829591-45829613 CTGAGCCTGCAGGGACTGGGAGG + Intergenic
1128082695 15:64865776-64865798 CATTTCCTGCAGGACCTGGGTGG - Exonic
1128635122 15:69298240-69298262 CTGTTCCTTCAGCACCTGGGAGG + Intergenic
1128965184 15:72051550-72051572 CTGAGCCTGCAGGGACTGGGCGG - Intronic
1129270228 15:74415696-74415718 CTGCTCCTGCCACACCAGGGAGG + Intronic
1129656790 15:77529863-77529885 GTGCCCCTGCAGGGCCTGGCAGG + Intergenic
1129734608 15:77952594-77952616 CTGCGCCTCCAGCACCTTGGGGG - Intergenic
1129840982 15:78743397-78743419 CTGCGCCTCCAGCACCTTGGGGG + Intergenic
1132501059 16:284870-284892 CTCGTCCTGCAGGTCCTGAGGGG - Exonic
1132995071 16:2818482-2818504 CTGCTCCTGCAGCAGAAGGGTGG - Intronic
1133295876 16:4752048-4752070 TGGCTCCTGAAGGGCCTGGGAGG - Exonic
1134209924 16:12267591-12267613 CTGCTCCTGCAGGATGAGGGAGG - Intronic
1134819910 16:17238627-17238649 CTGGTCATGCAGGACCTTGTAGG - Intronic
1134823006 16:17261743-17261765 CTGAGGCTGCAGGAGCTGGGAGG + Intronic
1135626453 16:23999206-23999228 CTCCTTCTGCATGACCTTGGAGG + Intronic
1135627726 16:24010721-24010743 CTTCTCCTGCAGGTTTTGGGAGG + Intronic
1136368594 16:29821477-29821499 CTGCTCCCCCAGAACCTGGGAGG - Intronic
1136776869 16:32876652-32876674 CTGCTCCTCCCTGACCTGTGAGG + Intergenic
1136893748 16:33984861-33984883 CTGCTCCTCCCTGACCTGTGAGG - Intergenic
1137847986 16:51710594-51710616 CTGCTCCAGCAGGTCCGGGGAGG - Intergenic
1139209868 16:65066755-65066777 CTGCTCCTCCAGTCCCTGTGAGG + Intronic
1139606457 16:68022487-68022509 CTGCTGGTGCGGGACCTGGAGGG - Exonic
1141426855 16:83949754-83949776 CTGCTCCTGAGGGCCCCGGGAGG + Intronic
1141438491 16:84014397-84014419 CTGCTCCTGCATGCTCTGAGCGG - Intronic
1141949807 16:87333241-87333263 CTGCCACTGCAGGGCTTGGGCGG - Intronic
1142304826 16:89279345-89279367 CTGCTGCTGCAGCTGCTGGGTGG + Exonic
1142388657 16:89783628-89783650 CTGGTCCTGCAAGTCCAGGGCGG + Intronic
1203079285 16_KI270728v1_random:1138761-1138783 CTGCTCCTCCCTGACCTGTGAGG + Intergenic
1142469873 17:157301-157323 CTGGTCCTTCTGGGCCTGGGGGG + Intronic
1142589678 17:997221-997243 CTGCTCCTGCAGTACCTGGTGGG + Exonic
1142848717 17:2694262-2694284 CTCCTTCAGCAGGACCTGGGGGG + Exonic
1143017301 17:3897829-3897851 GTTCTCCTGCAGGCCCAGGGTGG + Exonic
1143148077 17:4789503-4789525 CGACTCCTGCCGGACCTGGTGGG - Exonic
1143408715 17:6695866-6695888 CTCCTCCTGCAGCACCTTGAGGG + Exonic
1143502586 17:7347836-7347858 CTGCTCCTGAAGACACTGGGAGG - Intronic
1144278468 17:13699883-13699905 TTGCTCCTGCAGGCTCTGGGAGG - Intergenic
1144465283 17:15492444-15492466 CTGCTGCTGGGAGACCTGGGTGG - Intronic
1145019254 17:19416760-19416782 CTGCTCCAGCAGGACTAAGGTGG + Exonic
1145041154 17:19579457-19579479 CTGCTCCTGGCGGCCCGGGGTGG - Intergenic
1145273060 17:21414827-21414849 CAGGTCCTGCATGTCCTGGGGGG + Intronic
1146637983 17:34520121-34520143 TTGCTGCTGTATGACCTGGGAGG - Intergenic
1147305537 17:39561671-39561693 CAGCTCCAGCAGGAGGTGGGAGG - Intronic
1147374678 17:40016530-40016552 GGGCTCCTGCAGGCCCTGGAAGG + Exonic
1147958706 17:44152999-44153021 CTGCACTTCCAGGCCCTGGGTGG + Intronic
1148324041 17:46773038-46773060 TTGAACCTGCAGGCCCTGGGAGG - Intronic
1148577452 17:48722054-48722076 CGGGACCTGCAGGACCTAGGCGG - Intronic
1148701289 17:49588547-49588569 CTGCTCCTGCCAAGCCTGGGTGG + Intergenic
1150209877 17:63436088-63436110 CAGCCCGTGCAGGACCTTGGTGG + Exonic
1151293147 17:73164899-73164921 GTCCTTCTGCAGGACCCGGGAGG + Intergenic
1151338872 17:73456997-73457019 CTGATCCAGCAGGTCTTGGGGGG - Intronic
1151627389 17:75285671-75285693 CTTCTCATGCATGACATGGGAGG + Intronic
1151708392 17:75784939-75784961 CTGTGCCTGCAGCACCTGAGCGG - Exonic
1151975001 17:77479740-77479762 CCTCCCCAGCAGGACCTGGGGGG - Intronic
1151984265 17:77531970-77531992 CTGCCCTTGCAGGAGCTTGGAGG + Intergenic
1152380808 17:79941507-79941529 CAGATCCTGCAGGAGCTGAGAGG - Intronic
1152456975 17:80422252-80422274 CTGCTCTTGGAGGTCCAGGGAGG + Intronic
1152592816 17:81222234-81222256 CCGCCCCTTCAGGTCCTGGGAGG - Intronic
1152686575 17:81696635-81696657 CTGCTCCTGCAGGCGCTGGATGG - Exonic
1152785752 17:82247091-82247113 CTGCTCCTGGACACCCTGGGGGG - Intronic
1153475575 18:5495011-5495033 CTGCCCCTTCAGGGCCTGTGTGG - Intronic
1153932391 18:9889711-9889733 CTTCTGCTGCAGAACCTGGCTGG + Intergenic
1154266466 18:12883517-12883539 CTGCTCCCACAGGTCCTGCGCGG + Intronic
1154385398 18:13887686-13887708 CAGCTCCTCGACGACCTGGGGGG + Intronic
1156713334 18:39975522-39975544 CTTCTCCAGCAGTACCTGGCTGG - Intergenic
1157134992 18:45045339-45045361 TTGCACCTGCTGAACCTGGGAGG + Intronic
1158960942 18:62587326-62587348 GTCCTGCTGCAGGAGCTGGGAGG + Intronic
1159818707 18:73112193-73112215 ATCCTACTGCTGGACCTGGGAGG - Intergenic
1160090040 18:75818407-75818429 CTGCTCCCAGAAGACCTGGGAGG + Intergenic
1160541736 18:79627642-79627664 CTGCTCCTGGAGAACGTGGTTGG + Intergenic
1160798368 19:955939-955961 CTCCTCCTGCAGCCCCTGGAGGG - Intronic
1160804980 19:988678-988700 CTGCCCCTGGAGGCCCTGGGAGG + Intronic
1160836462 19:1126963-1126985 AAGCTCCTGAAGGACCTGGGTGG - Intronic
1161156173 19:2732887-2732909 GTGCTGCTGCAGGGCCTGGCGGG - Exonic
1161208399 19:3054035-3054057 CTGCTGCTGCAGGGCGGGGGAGG + Exonic
1161319866 19:3636196-3636218 CTTGTCCTGCAGGAGTTGGGGGG + Intronic
1161619195 19:5289533-5289555 CAGGTCGTGCAGGACCTGGTGGG - Intronic
1162028715 19:7908351-7908373 CAGCTCCTGCAGGGGCTGGCAGG + Intronic
1162028891 19:7909050-7909072 CAGCTCCTGCAGGGGCTGGCGGG - Intronic
1162052997 19:8046403-8046425 CTGCCCCTGCAGGATGTGCGGGG - Intronic
1162060033 19:8089485-8089507 CTGCTCCTTCCTGTCCTGGGAGG + Intronic
1162158871 19:8697496-8697518 CTGCTCCCGCAGGACCCAGCAGG + Exonic
1162860321 19:13501614-13501636 CTGGTCCAGCAGGATTTGGGTGG - Intronic
1163152338 19:15422822-15422844 CTGCCCCTGCTGGACCAGGTGGG + Exonic
1163155703 19:15438963-15438985 CTGCTGCTGCTGCCCCTGGGTGG + Intronic
1164069402 19:21752765-21752787 CTCCTGCTGCAGTACCTTGGAGG - Intronic
1164491902 19:28722629-28722651 TTGCCCCTGAAGGAGCTGGGTGG - Intergenic
1164576689 19:29409289-29409311 GGGCTCCTGCAGGGCCTGGCCGG + Intergenic
1165824386 19:38697600-38697622 CTGCTCCTGCAGGCTCTGCAGGG - Intronic
1165830017 19:38725818-38725840 CTGCTCCAGCAGGTCCAGGTTGG - Exonic
1166248209 19:41546089-41546111 CTGGGCCTGAAAGACCTGGGAGG - Intergenic
1166267605 19:41694938-41694960 CTGGCCCTGCAGGACCCAGGAGG - Intronic
1166669483 19:44701353-44701375 CGTCTGCCGCAGGACCTGGGAGG - Exonic
1166919978 19:46222612-46222634 CTGCAGCTGCAGGACAGGGGAGG + Intergenic
1167198781 19:48049557-48049579 CCACGGCTGCAGGACCTGGGCGG + Intronic
1167473068 19:49686076-49686098 CACCTCCTGCAGGACATGAGAGG - Exonic
1167713510 19:51126143-51126165 CTGCTCCTCCAGCCCCAGGGAGG - Intronic
1168345567 19:55648778-55648800 CTTCTCCCCCAGGACCTAGGCGG + Exonic
1168393226 19:56027674-56027696 CTGCAGCTGCAGGACGTGGTGGG + Exonic
925062621 2:905036-905058 CTGCTCATGCCAGGCCTGGGTGG - Intergenic
925299160 2:2797933-2797955 CTTCCAGTGCAGGACCTGGGAGG - Intergenic
925390000 2:3488124-3488146 CTGCTGCTGCAGTAGCTGTGTGG - Intergenic
925415868 2:3669787-3669809 CTGCTCCTCCCGGAGGTGGGAGG + Intronic
926101702 2:10122412-10122434 CTGGTCCCGCGGGACCTGTGGGG + Exonic
926142344 2:10375181-10375203 CTGCCCCAGCAGGCCCTGGCTGG + Intronic
926159626 2:10478396-10478418 CAGCTCCTGGAGGCCCTAGGTGG - Intergenic
926210136 2:10863199-10863221 CTGGTCCTTCAGGGTCTGGGAGG + Intergenic
926247792 2:11133477-11133499 CTGCGCCTTCAGAGCCTGGGGGG - Exonic
926306036 2:11637795-11637817 CTTCTCCAGCAGGAGCTGGGCGG - Exonic
928432725 2:31234208-31234230 CCGCTCCTGCCGGACCGAGGCGG - Intergenic
928471489 2:31580727-31580749 CAGCTCCTGCAGGAACCAGGCGG + Exonic
928877120 2:36053099-36053121 GTTCTCCTGCAGGAACTGGAAGG - Intergenic
930718083 2:54612216-54612238 CTGCTCCTTCAGGAACTGAAGGG - Exonic
932406101 2:71513434-71513456 CTCCTCCTGCAGGACTTGGCGGG + Intronic
932702333 2:74000417-74000439 CTGCTCTGTCAGGACCCGGGAGG + Intronic
933887024 2:86728180-86728202 CTGGTCCTCCAGGAACTTGGAGG + Intronic
933923154 2:87068530-87068552 CTGGTCCTCCAGGAACTTGGAGG - Intergenic
935015765 2:99180830-99180852 CTGCTCCTGCAGGTTCTGAAAGG - Exonic
936271859 2:111055144-111055166 CTGGTCCTGCAGGACCAGGCAGG + Intronic
937236086 2:120432641-120432663 CTGCTCCTCCTGGCCCTGGCAGG - Intergenic
937662906 2:124451673-124451695 TTGCTTCTGCAGGACCCAGGAGG + Intronic
937869269 2:126776307-126776329 CTGCTCCTGCAGGACTCTTGGGG - Intergenic
938305470 2:130251640-130251662 CTGCTGGGGCAGGACCTGGGAGG - Intergenic
938314330 2:130315616-130315638 TTCCTCCTGCAGGACCTTTGGGG - Intergenic
938767380 2:134469286-134469308 CAGCTCCTGGAGGACTCGGGTGG + Intronic
940612290 2:156006783-156006805 CTGAGCCTGCAGGCCCGGGGTGG + Intergenic
940709517 2:157144663-157144685 CTGCTCCTGCGCTACCCGGGAGG - Intergenic
940907109 2:159179474-159179496 ATGATCCTGCAGAAGCTGGGTGG - Intronic
941770756 2:169343231-169343253 CTGTGCCTTCAAGACCTGGGAGG + Intronic
942186066 2:173426336-173426358 ATGCCCCTTCAGGACCTGGAAGG + Intergenic
944242699 2:197500688-197500710 CTGCTTCTGCAGGGCCTTTGTGG + Intronic
945046222 2:205784371-205784393 CTGTTCTCGCAGGCCCTGGGTGG - Intronic
946349941 2:219143676-219143698 CTGGTCCTGTAGGTTCTGGGTGG - Intronic
946421634 2:219568282-219568304 CGGCCCCTGCAGGACGTGGAGGG - Exonic
947598069 2:231426514-231426536 CTTCTGCTTCAGGTCCTGGGAGG - Intergenic
947614743 2:231548572-231548594 CTGCTCCTCCATGACCTCGAGGG - Intergenic
948706020 2:239792918-239792940 GTGACCCTGCAGGGCCTGGGTGG - Intronic
1169209029 20:3755437-3755459 CTCCTCCAGCAGGGCCTGGATGG - Intronic
1170577176 20:17673170-17673192 CTCCTCCTCCAGGATCTGTGGGG - Intronic
1171106571 20:22439130-22439152 CTGCCCCTACAGGCCCTGGGTGG + Intergenic
1171328561 20:24317810-24317832 CTGGTCCTGGAGGAAGTGGGTGG - Intergenic
1171462017 20:25303351-25303373 CTGCTTCGGAAGGACATGGGAGG - Intronic
1172645875 20:36469250-36469272 CTGCTGCTGCAGACTCTGGGAGG - Intronic
1172845700 20:37928795-37928817 GTACTGCTGCAGGAGCTGGGAGG + Intronic
1173250653 20:41362663-41362685 CTCCTCCAGCAGGGCCAGGGAGG + Exonic
1173430403 20:42982715-42982737 CTGCTCATCAAGGACCTGGGAGG - Intronic
1173767777 20:45629856-45629878 CTGCTGCTGCAGGCCCAGGGAGG + Exonic
1173773797 20:45685928-45685950 CTGCTGCTGCAGGCCCAGGGAGG - Intronic
1174412198 20:50343541-50343563 CTGGTCCTGCAGACCCTGGAGGG - Intergenic
1174454900 20:50642015-50642037 CTGCTTCCGCAGAACCTGGCCGG + Intronic
1174471902 20:50767715-50767737 CTGCTTCCGCAGAACCTGGCCGG - Intergenic
1174962414 20:55173672-55173694 CTGCTTCTTCAGGTCCAGGGTGG - Intergenic
1175220268 20:57412615-57412637 CTGGGCCGGCAGGACCTGCGGGG - Intergenic
1175467943 20:59205267-59205289 CAAATCCTGCAGGGCCTGGGTGG - Intronic
1175514676 20:59561380-59561402 CTGCTCCTGAAGGCCCTGGCAGG - Intergenic
1175822516 20:61918062-61918084 CAGCTGCTGGAGGGCCTGGGGGG + Intronic
1175972701 20:62694865-62694887 CTGATCCTGGATGATCTGGGTGG + Intergenic
1176146702 20:63568678-63568700 CTGCACCTCCAGGACCAGGCGGG + Exonic
1176151643 20:63594478-63594500 CTGCCCCAGCAGGACGTGGAAGG + Intronic
1176230996 20:64032833-64032855 CTCCTCCTGCTGCTCCTGGGGGG - Exonic
1176233712 20:64044627-64044649 CTGCCCCAGCAGGACCTTGCTGG + Intronic
1177318143 21:19487757-19487779 CCTCACCTGCAGAACCTGGGAGG - Intergenic
1177640180 21:23835177-23835199 ATGCTGCTGCAGGACCTGCATGG + Intergenic
1179300712 21:40107229-40107251 CTGCTCCTGAATGACTTTGGGGG - Intronic
1179476300 21:41648373-41648395 CTGCTCCTGAAGGAGCTGTGTGG - Intergenic
1180066914 21:45417171-45417193 CTGCTCCTGGGGAATCTGGGCGG - Intronic
1180160976 21:45998600-45998622 CGGCTCCTGCAGGCCCTGCGAGG + Intronic
1180179701 21:46112438-46112460 CTGCTCCTTCAGGTTCTGGTTGG - Exonic
1180210844 21:46294959-46294981 CTGCTCCCTCCAGACCTGGGTGG + Intronic
1182085915 22:27561088-27561110 CTGATCCTGAGGGGCCTGGGGGG + Intergenic
1182269416 22:29144248-29144270 CTGCACCTGCCGCCCCTGGGAGG + Intronic
1182697709 22:32207601-32207623 CTTCTCCTGCAGAATCTGGAGGG + Intergenic
1183332775 22:37230243-37230265 CTCCCCCTGCCGGAACTGGGAGG - Intronic
1183377909 22:37475740-37475762 CTGCACCTGCAGGAGTTGGAGGG + Intronic
1183599618 22:38832364-38832386 CTGCCCCAGCAGGAGCTGAGTGG - Intronic
1184550500 22:45201988-45202010 CTGCTCCTTCAGTATTTGGGAGG - Intronic
1184751805 22:46490577-46490599 CTTTTCAAGCAGGACCTGGGAGG + Intronic
1185148060 22:49149939-49149961 CTCCTCCTCCAGGATGTGGGTGG - Intergenic
1185231717 22:49687610-49687632 CTGAGACTGCAGGGCCTGGGAGG - Intergenic
1185249700 22:49794242-49794264 CTGCTCCTCCAGGCCCAGGTGGG + Exonic
949688332 3:6604155-6604177 CTACTCCTTCAGGAGCTGGATGG + Intergenic
950097610 3:10339041-10339063 CTGCTCCTACAGGAAATGGAAGG - Intronic
950569394 3:13790749-13790771 CTGCCCCTTCAGGCCCAGGGTGG + Intergenic
953418372 3:42735899-42735921 CTGCTTCAGCTGGTCCTGGGGGG + Exonic
953565251 3:44026895-44026917 CAGCTCCTGGAGGACCTCCGAGG - Intergenic
953899421 3:46831183-46831205 TTGCTCTGGCAGGACTTGGGAGG - Intronic
953929320 3:46998104-46998126 CTGCTCCATCAGCAGCTGGGCGG - Exonic
954405539 3:50343192-50343214 CTGCTTCTGCAGCTCCTGGGAGG + Exonic
954753547 3:52826976-52826998 CTGCTCCTCCAGGACAGGTGGGG + Intronic
954964889 3:54601537-54601559 CTGATCCTGCAGGCTTTGGGTGG - Intronic
956166176 3:66399967-66399989 CATCTCCTGCAGGCCCTGAGGGG - Intronic
957214067 3:77296750-77296772 CTGCTCCTGCAGGACAAAAGAGG + Intronic
958529595 3:95309537-95309559 CTGCTTCTGCAGGGCCTGCATGG + Intergenic
958839389 3:99185866-99185888 CTGCTCCTGGGGGACGGGGGAGG - Intergenic
961361575 3:126371322-126371344 CAGCTCCAGCAGGACCTCTGTGG - Intergenic
961844265 3:129747858-129747880 CTGCTACTGCAGGACATGGGTGG - Intronic
962241536 3:133754820-133754842 CTGCACCAGCAGCACTTGGGAGG + Intronic
963105647 3:141645035-141645057 CTCTTCCTGCAGTGCCTGGGCGG - Intergenic
963766330 3:149339996-149340018 CTGGTCCTCCAGTAACTGGGAGG + Intergenic
966933121 3:184688562-184688584 CTGCCCCTGCAGGAGCTGCCAGG + Intergenic
968534300 4:1113634-1113656 GTTCTCCCGCAGCACCTGGGAGG + Intergenic
968690362 4:1986948-1986970 CTGCACCTGCTGGCCCAGGGAGG - Intronic
968824838 4:2887579-2887601 TTGCACCTGCAGAACCTGGCAGG + Intronic
968833930 4:2949035-2949057 CTGCTTCAGAAGGACCTGGAAGG + Intronic
969098440 4:4751552-4751574 CTGCTGGTGCCGGACCTGTGTGG + Intergenic
969216030 4:5723144-5723166 CTGCGCCTACAGGTCTTGGGTGG + Intronic
969289605 4:6230288-6230310 CTGCTCCAGCAGGTTCAGGGTGG + Intergenic
969312902 4:6364381-6364403 CAGCTCCTGCAGGGCCTTGGAGG + Intronic
969642083 4:8405011-8405033 CTGCTCAGGCAGGGCCTGGCAGG + Intronic
971174123 4:24264407-24264429 CTGCTCCTGTGGGCCCTTGGTGG - Intergenic
971774943 4:30950999-30951021 AAGCCCCTGCAGGAGCTGGGAGG - Intronic
972355879 4:38279270-38279292 CTGGTTCTGCAGGCCCGGGGTGG - Intergenic
973037174 4:45420563-45420585 CTCCACCTGCAGCACCTGTGCGG + Intergenic
975830559 4:78363915-78363937 CTCCTCCTGCAGAACCTGCCAGG + Exonic
976021449 4:80633315-80633337 ATGCTCCTGTAGTACTTGGGAGG + Intronic
976856346 4:89609551-89609573 CTGCTCCTGCAGGACTCAGGAGG + Intergenic
977714165 4:100162412-100162434 CTGGTCCTGCAGCCCCTGGCCGG - Intergenic
978249192 4:106610309-106610331 CTCCTGCTGCTGCACCTGGGCGG - Intergenic
979530080 4:121760811-121760833 CAGATCCTGAAGGACATGGGTGG - Intronic
980127480 4:128787787-128787809 CTGGTCTGGCAGGGCCTGGGTGG - Intergenic
980158533 4:129133883-129133905 GTGCTCCTGCAGGACCTGCTTGG + Intergenic
982176538 4:152710331-152710353 CTGCTCCTCCAGGACTAGAGTGG + Intronic
984879968 4:184402053-184402075 CTGCTCCTTCTAGCCCTGGGAGG - Intronic
985203323 4:187506043-187506065 CTGCACCTGCAGCCCCTGTGCGG + Intergenic
985336891 4:188905564-188905586 CAGCTCCTGCAGGACCCAGTTGG - Intergenic
985451423 4:190065706-190065728 CGGCTCCTGGAGCGCCTGGGAGG - Intergenic
985452412 4:190068998-190069020 CGGCTCCTGGAGCGCCTGGGAGG - Intergenic
985453397 4:190072295-190072317 CGGCTCCTGGAGCGCCTGGGAGG - Exonic
985454387 4:190075588-190075610 CGGCTCCTGGAGCGCCTGGGAGG - Exonic
985455375 4:190078881-190078903 CGGCTCCTGGAGCGCCTGGGAGG - Exonic
985456360 4:190082175-190082197 CGGCTCCTGGAGCGCCTGGGAGG - Exonic
985457347 4:190085475-190085497 CGGCTCCTGGAGCGCCTGGGAGG - Intergenic
985458334 4:190088768-190088790 CGGCTCCTGGAGCGCCTGGGAGG - Exonic
985459323 4:190092068-190092090 CGGCTCCTGGAGCGCCTGGGAGG - Exonic
985463575 4:190174837-190174859 CGGCTCCTGGAGCGCCTGGGAGG - Exonic
985478005 5:90774-90796 CTGCTCTGGCAGGAGCTGTGGGG + Intergenic
985563157 5:602089-602111 CCGCAGCTGCAGGAGCTGGGCGG - Intergenic
985606779 5:862154-862176 CTGATCCTGCAGGACTTAGAGGG - Intronic
985781217 5:1872771-1872793 CAGCACCTGCAGGCCCTGGATGG + Intergenic
990000467 5:50885952-50885974 CTACTCCTTCAGGTCCTGGTGGG + Intergenic
990528202 5:56649652-56649674 CAACCCCTGCAGAACCTGGGAGG + Intergenic
994605533 5:101962393-101962415 CTGCACCTGCAGCCCCTGTGCGG - Intergenic
996224638 5:120976824-120976846 TTGCTCCTGCAGGACAGGTGGGG + Intergenic
998154214 5:139775266-139775288 GGGCTGCTGCAGTACCTGGGAGG + Intergenic
998953270 5:147413259-147413281 CTTCGCCTGCAGGACCAGGAGGG - Intronic
1001926470 5:175640624-175640646 CTCCTCCCGGAGGAACTGGGAGG + Intergenic
1001961716 5:175883741-175883763 GTGCTCGTGCTGGCCCTGGGTGG + Exonic
1002589198 5:180277308-180277330 CTCCTTCTGCAGGCTCTGGGGGG + Intronic
1005136961 6:22580272-22580294 CTGATCCTGTAGGACCAGGATGG + Intergenic
1005734272 6:28731160-28731182 CTGCTCCTTAAGGAACTAGGAGG - Intergenic
1005897757 6:30192344-30192366 CTGATCCTGCAGGGCCTGCCCGG + Intronic
1005947261 6:30603507-30603529 CTCCTCCTCCAGGGCCTTGGGGG + Exonic
1006296708 6:33173071-33173093 CCACTCCTGGAGGACCAGGGGGG + Exonic
1006727468 6:36210387-36210409 GTCCGCCTGCGGGACCTGGGAGG + Exonic
1007595248 6:43047093-43047115 CAGTTCCTGGAGCACCTGGGTGG + Exonic
1007605710 6:43116375-43116397 CTGCTGCCACAGGCCCTGGGCGG + Intronic
1007947351 6:45838326-45838348 CTTCTCCTGCAGGACTGTGGTGG + Intergenic
1009696035 6:67104351-67104373 CTGTTCCTGAAGGACCTTGTAGG - Intergenic
1011494806 6:87927343-87927365 CTGCTCCTTCTGGACTTTGGGGG + Intergenic
1015512076 6:134047935-134047957 CTGCTGCTTCAGAGCCTGGGAGG + Intronic
1015849931 6:137560832-137560854 CTGCTCCTGCAGGACCCAGGAGG - Intergenic
1016492007 6:144615898-144615920 CTGATCATGTAGGACCTGGTAGG - Intronic
1019144597 6:169968698-169968720 CTGCTCCTGCTGTAGCTTGGAGG + Intergenic
1019341547 7:511065-511087 CGGCTCCAGCTGGGCCTGGGGGG + Intronic
1019516711 7:1443270-1443292 CTGCTCCTCCTGGCACTGGGGGG - Intronic
1020427583 7:8086476-8086498 CAGCTCCTGCAGGAACTGCAGGG + Exonic
1021183472 7:17535245-17535267 CAACACCTGCAGTACCTGGGTGG - Intergenic
1021615523 7:22499626-22499648 CTACTCTTTCAGGATCTGGGTGG - Intronic
1021934992 7:25621528-25621550 CTCCTCCTGCAGGGCCAGGGAGG - Intergenic
1022497484 7:30862161-30862183 CATCTCCTGCAGGCCCTCGGGGG - Intronic
1022524662 7:31029220-31029242 CTGCCACTGCAGGACTTTGGAGG + Intergenic
1023970323 7:44986289-44986311 GGGCTTCTGCATGACCTGGGTGG - Intergenic
1023989911 7:45122470-45122492 GTGCTCCGGCAGGACATAGGAGG - Intergenic
1024279915 7:47710368-47710390 CTGGTGCTGCAGGAGTTGGGAGG - Intronic
1024445812 7:49477369-49477391 CTGCTCCTGAATGACTTTGGGGG - Intergenic
1024917352 7:54515893-54515915 CTGTTCCTGCAGGACCCAGGAGG - Intergenic
1025042752 7:55662415-55662437 CTCCTCCTTCAGGCCCTGGACGG - Intergenic
1027222788 7:76224478-76224500 TTGCTCCTGCAGGACTGGGTGGG + Intronic
1028376974 7:90155009-90155031 CTACTCTTTCAGGATCTGGGTGG + Intronic
1028640681 7:93039410-93039432 CAGCTGCAGCAGCACCTGGGAGG - Intergenic
1028940074 7:96512002-96512024 CTGCTGCTGCTGTTCCTGGGAGG + Intronic
1029260814 7:99301593-99301615 CTGGACCTGCAGGTCCTGGGGGG - Intergenic
1029976039 7:104834732-104834754 CTCCGCCTGCAGGACCTGCATGG - Intronic
1031761373 7:125716666-125716688 CTGGTCCTGCAGGACCCAGGAGG - Intergenic
1032002433 7:128274152-128274174 GTGCTTCTGCAGTACCAGGGAGG - Intergenic
1033165552 7:139035935-139035957 ATGTTCCTGAAGGACCTGCGCGG - Exonic
1034227584 7:149495936-149495958 GTGGTCCTACAGCACCTGGGTGG + Intronic
1034275884 7:149823716-149823738 CTGCTCCAGCAGCCCCTGGGTGG - Intergenic
1034972848 7:155429952-155429974 CTGCTGCTTCAGGACTTGGCAGG + Intergenic
1035027267 7:155834205-155834227 GTGCTCTGGAAGGACCTGGGGGG + Intergenic
1035150975 7:156872898-156872920 TTGCTCCTGCAGGACCCAGGAGG + Intronic
1035548127 8:499424-499446 CTGTCCCTGTAGCACCTGGGTGG + Intronic
1036089747 8:5652761-5652783 CTGATTCTGCAGGTCCAGGGAGG + Intergenic
1036181589 8:6590431-6590453 CAGGCCCTGCAGGCCCTGGGTGG + Intronic
1037888784 8:22610404-22610426 CTGCTGCTGCAAGTCCTGAGAGG + Intronic
1038023767 8:23571491-23571513 CTGCTCCTGCAGGAACTCATAGG - Exonic
1038420202 8:27429727-27429749 CTTCACCTGCAGGTCCTGGGGGG - Intronic
1039753740 8:40500326-40500348 CTGTTTCTGCAGGACCTATGTGG - Intergenic
1039992122 8:42497408-42497430 CTGATTCAGCAGGGCCTGGGTGG + Intronic
1041364044 8:57082948-57082970 CTGCTCCTGCAGGACCTGGGAGG + Intergenic
1041636976 8:60155850-60155872 CTGCTCCTACAGGACCCAGGAGG + Intergenic
1041773936 8:61503499-61503521 TTTCTGCTGCAGGACCTGGGAGG - Exonic
1041781665 8:61584128-61584150 CTTCTCCTGCAGGTCTTTGGTGG - Intronic
1042866382 8:73359870-73359892 CTGCTACTGCAGGGCCAGAGTGG + Intergenic
1044227427 8:89735796-89735818 CTGCTCCTGCAGAACCTGGGAGG + Intergenic
1044827478 8:96212132-96212154 ATCCTCCTGCAGGAACTAGGGGG - Intergenic
1045324637 8:101109140-101109162 CAGACCCTCCAGGACCTGGGCGG - Intergenic
1045452199 8:102338555-102338577 CAGTTCCTGCAGGTCATGGGAGG - Intronic
1046398807 8:113676553-113676575 CTGCTGCTGCAGGGCCTGCATGG + Intergenic
1047960354 8:130007236-130007258 CTGCTCCTGCTGGACCCTGCTGG - Intronic
1048461773 8:134627104-134627126 CTGCTCTTGCTGGACATGGATGG - Intronic
1049469435 8:142768878-142768900 CTGCTCATTCAGGGCCTGGGAGG + Intronic
1049612507 8:143562066-143562088 CTGCTGCTGGAGGGCCTGGAGGG + Exonic
1049791025 8:144472800-144472822 CTGCACCTGGTGGACCTGGCGGG + Exonic
1055786003 9:79869540-79869562 CTGCTCCCTGAGGACCTGAGAGG - Intergenic
1057119637 9:92559475-92559497 CTGCTCCTGCAGGACCTGGGAGG - Intronic
1058600862 9:106668680-106668702 CTGCTCCTGCTGGGCCTAGGAGG - Intergenic
1059438558 9:114290216-114290238 CAGCCCCTGCAGGCCCTGGGGGG - Exonic
1060280746 9:122214055-122214077 CTGCGCCTGCATAACCTGCGGGG + Exonic
1060545177 9:124455075-124455097 CTGCTCCTCCAGGACCAGGCTGG - Exonic
1060720547 9:125974035-125974057 CCTCTCCTTCAGGACCTTGGGGG + Intergenic
1061194948 9:129102536-129102558 CTGCCCGTGGAGTACCTGGGGGG - Exonic
1061324287 9:129853581-129853603 CTGCACCAGCAGGTCCTTGGTGG + Intronic
1061391778 9:130320806-130320828 CTGCCCCTCCAGGACCCGGACGG - Intronic
1061846326 9:133390544-133390566 CTGCTGCTGCAGAACCAGGTGGG + Intronic
1061912561 9:133732717-133732739 CTTTCTCTGCAGGACCTGGGGGG + Intronic
1062200476 9:135300242-135300264 TTGCTCCTTCTGGAGCTGGGTGG - Intergenic
1062273446 9:135720101-135720123 CTGCTCCTGCTGGCCCTGCCTGG - Intronic
1062521888 9:136961397-136961419 CTGTCCCTGCAGGCCCTGGTGGG - Intergenic
1185589666 X:1266296-1266318 CAGCTCCTGCAGGAATGGGGAGG + Intergenic
1186686066 X:11925636-11925658 CTGCTCCTGAATGACTTTGGGGG + Intergenic
1187275156 X:17810610-17810632 CTCCTCCGGCAGCTCCTGGGAGG - Intronic
1187392310 X:18894199-18894221 CTGTTCTTGCAGGACCAGGTGGG - Exonic
1188806703 X:34599689-34599711 CTGCTCCTGAATGACTTTGGGGG - Intergenic
1189246374 X:39566545-39566567 CTCCTCCTTCAGGACCCAGGAGG + Intergenic
1189487135 X:41442615-41442637 CTGCCCCTCCAGGACCGCGGCGG + Intergenic
1189535987 X:41935964-41935986 CTTCTCCTTCATGACCTGAGAGG + Intergenic
1192069200 X:67918766-67918788 CTGTTCCTGCAGGACCTGGGAGG - Intergenic
1192197330 X:69037172-69037194 CTGCTCCTGCAGGGGCTGGTGGG - Intergenic
1192822586 X:74659910-74659932 CTGCTGCTGGAGGATGTGGGAGG + Intergenic
1192970382 X:76222015-76222037 CTGCTCCTGCTGGACCCAGGAGG - Intergenic
1195075694 X:101325688-101325710 CTGCTCTTGCAGGACCCAGGAGG + Intergenic
1196561496 X:117154555-117154577 CTGCTCCTGCATGACCTACTTGG + Intergenic
1197702468 X:129609682-129609704 CACCTCCCTCAGGACCTGGGAGG + Intergenic
1198448235 X:136739922-136739944 CAGATCCTGGAGGACCTTGGAGG + Intronic
1199336100 X:146620382-146620404 CTGCTGCTGCAGCTGCTGGGTGG + Intergenic
1200093858 X:153648185-153648207 GTGCTCCTGTACGACCAGGGCGG + Exonic
1200102990 X:153697392-153697414 CTGCTCCTCCCTGACCTGTGAGG - Intergenic
1201177129 Y:11315978-11316000 CGGCTCCTGGAGCACCTGGAAGG - Intergenic