ID: 1057121857

View in Genome Browser
Species Human (GRCh38)
Location 9:92583008-92583030
Sequence CACTGTGTTTGACAGGCACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057121854_1057121857 10 Left 1057121854 9:92582975-92582997 CCCAAAAGGTGTTGTCTTCTGCA 0: 1
1: 0
2: 0
3: 16
4: 151
Right 1057121857 9:92583008-92583030 CACTGTGTTTGACAGGCACATGG No data
1057121853_1057121857 15 Left 1057121853 9:92582970-92582992 CCTCTCCCAAAAGGTGTTGTCTT 0: 1
1: 0
2: 0
3: 15
4: 143
Right 1057121857 9:92583008-92583030 CACTGTGTTTGACAGGCACATGG No data
1057121855_1057121857 9 Left 1057121855 9:92582976-92582998 CCAAAAGGTGTTGTCTTCTGCAG 0: 1
1: 0
2: 0
3: 14
4: 139
Right 1057121857 9:92583008-92583030 CACTGTGTTTGACAGGCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057121857 Original CRISPR CACTGTGTTTGACAGGCACA TGG Intronic
No off target data available for this crispr