ID: 1057125702

View in Genome Browser
Species Human (GRCh38)
Location 9:92614287-92614309
Sequence GGAGTTCACTGTTGCTGGGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 338
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 322}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057125702_1057125709 2 Left 1057125702 9:92614287-92614309 CCAGCCCAGCAACAGTGAACTCC 0: 1
1: 0
2: 0
3: 15
4: 322
Right 1057125709 9:92614312-92614334 TGGGTCAAGACAGTACTCAACGG 0: 1
1: 0
2: 1
3: 7
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057125702 Original CRISPR GGAGTTCACTGTTGCTGGGC TGG (reversed) Exonic