ID: 1057127757

View in Genome Browser
Species Human (GRCh38)
Location 9:92632677-92632699
Sequence GCAGAGTTGTCATCCTGGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 151}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057127757_1057127763 4 Left 1057127757 9:92632677-92632699 CCTCACCAGGATGACAACTCTGC 0: 1
1: 0
2: 0
3: 12
4: 151
Right 1057127763 9:92632704-92632726 GGCCTCTGCTAACATCCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057127757 Original CRISPR GCAGAGTTGTCATCCTGGTG AGG (reversed) Intronic
901780843 1:11593549-11593571 GCAGGGTGGTCAGCCAGGTGAGG + Intergenic
902375661 1:16028931-16028953 GCCCAGGTGTCACCCTGGTGGGG - Intronic
902563649 1:17295532-17295554 TCAGTGATGGCATCCTGGTGTGG - Intergenic
905179840 1:36158612-36158634 GCAGTGTTGTCAACCTTGTGGGG + Intronic
906076018 1:43052678-43052700 GCAGAGATGTCAACCTACTGGGG + Intergenic
906344820 1:45008535-45008557 GCAGAGCTGTCCTCCTGCAGAGG - Exonic
909056738 1:70829872-70829894 TCAGAGTTATCAGCCTGGAGGGG - Intergenic
909606139 1:77510118-77510140 GCAGAGTTGTCATTTTTGTGGGG + Intronic
912022078 1:105117876-105117898 GCAGAGATTTCATCTTGGTTTGG - Intergenic
913111758 1:115663652-115663674 CCCCAGTTGTCATCCTGGTGGGG - Exonic
915036353 1:152928985-152929007 CCAGAGCTTACATCCTGGTGGGG - Intergenic
919757159 1:201073425-201073447 GGAGAGTTATCAGCCAGGTGAGG - Intronic
919823225 1:201485788-201485810 GCAGAGAGGTCTTTCTGGTGAGG - Intronic
920117360 1:203630035-203630057 GCAGATTTGTCACACTGCTGTGG + Intronic
920808585 1:209259125-209259147 GCACACTTGTCTTGCTGGTGAGG - Intergenic
921219145 1:212961027-212961049 GCAGCATGGTCACCCTGGTGTGG - Intronic
923391193 1:233515501-233515523 GCAGAGTTGCCAGCTGGGTGAGG + Intergenic
924475562 1:244379494-244379516 GAAGAGTGGTCAACCAGGTGTGG - Intronic
924475974 1:244382171-244382193 GCAGGGCTGACATTCTGGTGGGG + Intronic
1063346563 10:5317643-5317665 GCAGAGCTGTCTTCCTTGTCTGG - Intergenic
1067356485 10:45533156-45533178 GCAGAGATGGCATCCTGGGATGG + Exonic
1069174502 10:65273611-65273633 GCAAAGTATTGATCCTGGTGAGG + Intergenic
1069669582 10:70190375-70190397 GCAGACTTGTCACCGTAGTGCGG - Intergenic
1069813912 10:71181443-71181465 GAAGAGTTTGCAGCCTGGTGGGG + Intergenic
1069815002 10:71188192-71188214 GGAGGGATGTCATCATGGTGCGG + Intergenic
1070273241 10:74978667-74978689 GCAGAGTTCTTAACCTCGTGTGG + Intronic
1073170827 10:101506600-101506622 GCAGAGTTGGCATCTTGGCTTGG - Intronic
1073408107 10:103316115-103316137 GCAGAGGTGACATTCTGGTATGG - Intronic
1073637899 10:105218460-105218482 ACAGAGTTTCCATTCTGGTGGGG + Intronic
1074486788 10:113891937-113891959 GCAGAGTTCTCATTCTGCTAGGG - Intronic
1075574815 10:123570683-123570705 GGAGAGTTGTGCTCCTGGGGAGG + Intergenic
1078989878 11:16635956-16635978 GCAGAGGTGTGGTCCTGGGGTGG + Intronic
1081765369 11:45606597-45606619 GCAGAGTTCTGATCCTGCTAGGG - Intergenic
1081931622 11:46875511-46875533 GCAGCAATGTCATCCTCGTGAGG - Exonic
1083076492 11:60044307-60044329 GGAGAGTATTCATCCTGGTTTGG - Intronic
1083753556 11:64777498-64777520 GCAGGGTTTTCATCCGGGAGAGG - Intronic
1084836819 11:71807897-71807919 GCAGAGTGGAAATACTGGTGAGG - Intergenic
1087602178 11:100329964-100329986 GCAGAGATTTCATCTTGGTTTGG - Intronic
1089939362 11:122399113-122399135 GCTGAGTTTTCTCCCTGGTGGGG - Intergenic
1090398848 11:126435732-126435754 CCATAGGTGTGATCCTGGTGTGG + Intronic
1090721068 11:129473724-129473746 GCAGAGCTTTCACCCTGGTCAGG + Intergenic
1090918401 11:131186967-131186989 TCAGAGTTGTGCTCCTGGAGGGG + Intergenic
1091892795 12:4073947-4073969 GCATGGTTGTGTTCCTGGTGAGG - Intergenic
1092402419 12:8188209-8188231 GCAGAGTGGAAATACTGGTGAGG + Intronic
1101062390 12:100985747-100985769 GCAGAGTTGGGATCATGGTGAGG + Intronic
1101672693 12:106891297-106891319 CCAGAGTGCTCTTCCTGGTGGGG - Intergenic
1104058876 12:125251137-125251159 GCAGAGGTGTCTTCCTGGGCTGG + Intronic
1106100418 13:26690510-26690532 GCAGACATGTCATCATGGTGGGG - Intergenic
1112630018 13:101150226-101150248 GCAGAGTGGTCGTCCTGGGTGGG + Intronic
1112906567 13:104429667-104429689 GCAGATTTGGCTCCCTGGTGAGG + Intergenic
1113458932 13:110468365-110468387 GCAGAGTTGTCACCATTTTGGGG - Intronic
1113984563 13:114303493-114303515 GCAGAATTGTCGGCCCGGTGCGG + Intronic
1114492311 14:23110956-23110978 GGAGAGCTGTCGTCCAGGTGGGG + Intergenic
1122018853 14:98819902-98819924 TCAGTGTTCTCTTCCTGGTGAGG - Intergenic
1122270568 14:100567031-100567053 CCAGAATTGGCATCCTGGGGAGG - Intronic
1124900817 15:33820752-33820774 CCAGAGTTGTCAAAGTGGTGAGG + Exonic
1125271205 15:37940605-37940627 GCAGAGCTGGCATTCTGGTAGGG - Intronic
1135623554 16:23976353-23976375 GCAGAGTTGTTAAACTGGTAGGG - Intronic
1135926527 16:26698522-26698544 GCAAACTTCTCCTCCTGGTGTGG - Intergenic
1138216856 16:55212189-55212211 GCAGAGCCCTCATCCTGCTGTGG + Intergenic
1138241464 16:55430741-55430763 GCATAGTTGTCATCATTCTGGGG + Intronic
1139546515 16:67652463-67652485 GGAGGACTGTCATCCTGGTGGGG - Exonic
1139960064 16:70712351-70712373 GCAGTGGCGTGATCCTGGTGGGG - Intronic
1140037288 16:71380993-71381015 CCAGAGCTGGCATCCTGGCGGGG + Intronic
1140999976 16:80298952-80298974 ACAGAGTTGTCTCCCTGGTGAGG - Intergenic
1141090320 16:81125833-81125855 GGAGATCTGTCAGCCTGGTGTGG + Intergenic
1141499025 16:84430914-84430936 GCAGAGTCCCCATCCTGCTGAGG - Intronic
1142167396 16:88599616-88599638 GCACAGTTGTCCTTCTGGGGAGG - Intronic
1145274618 17:21422225-21422247 GCAGAGCTCGCAGCCTGGTGAGG - Intergenic
1149443710 17:56697509-56697531 GCAAAGTTCGGATCCTGGTGAGG + Intergenic
1151379048 17:73712212-73712234 GCCAAGCTGTCATCCTGGTCAGG + Intergenic
1152857913 17:82676583-82676605 GCAGAGATGTCAAACTGGCGGGG - Intronic
1153814412 18:8780291-8780313 GCAGAGTTGCCTGCATGGTGCGG - Intronic
1156001788 18:32393210-32393232 GTACAGTTGTCAGCTTGGTGTGG - Intronic
1159110982 18:64056431-64056453 GCACAGTTTTAGTCCTGGTGGGG + Intergenic
1160145299 18:76358940-76358962 CCAGAGTTGCCAGCCTGGAGAGG + Exonic
1161107851 19:2453473-2453495 GCAGAGTTGGAAGCCTGCTGGGG - Intronic
1162068786 19:8141616-8141638 GCAGAGGGGTCAGGCTGGTGAGG - Intronic
1162755749 19:12858527-12858549 GCAGCGCTGTCTACCTGGTGCGG + Exonic
1165391646 19:35542481-35542503 GCAGAGATGTGGTCCTGGGGAGG - Exonic
1165692710 19:37876023-37876045 ATAGAGTTGACATTCTGGTGGGG + Intergenic
1168581035 19:57555969-57555991 GCTGATTGGCCATCCTGGTGGGG - Intronic
925159341 2:1673091-1673113 GCAGAGTTTGCAACCTGATGGGG + Intronic
925559861 2:5179591-5179613 GCTGATTTGTTTTCCTGGTGAGG + Intergenic
925832966 2:7914306-7914328 GCAGAGTGGGGAACCTGGTGGGG - Intergenic
926326206 2:11786512-11786534 GCACTGTTCTCATCATGGTGGGG - Intronic
928914674 2:36458267-36458289 CCAGAGGTATCCTCCTGGTGTGG - Intronic
932093460 2:68826698-68826720 GGAGAATGGGCATCCTGGTGGGG - Exonic
932808694 2:74805838-74805860 GCAGAGATGGCTTCCAGGTGAGG - Intergenic
936931114 2:117789859-117789881 ACTGAGTTCTCATTCTGGTGAGG - Intergenic
936960832 2:118072860-118072882 GAAGAGTTCTCAGCCTGGTAGGG - Intergenic
939078620 2:137632824-137632846 GCAGAGATGTGATCCTGGCTTGG + Intronic
939112152 2:138020948-138020970 GCAGAGTTGCCATTTTGGGGTGG + Intergenic
944153562 2:196588189-196588211 GTAGAGTTTTCATTCTGTTGGGG - Intronic
946332407 2:219017870-219017892 GCAGAGCTGCCAGCCTGGTGGGG - Intronic
946500686 2:220244363-220244385 GTTGAGTTGTCCTGCTGGTGTGG + Intergenic
948800047 2:240429394-240429416 GCAGGGTTGTCAGCCAGGTGAGG - Intergenic
1172002484 20:31790394-31790416 GAAGATTTGTCATCCTGGGAGGG - Intronic
1172371090 20:34392789-34392811 GCAGACTTGACCTCCTGGTTGGG + Intronic
1172893529 20:38283766-38283788 GAGGAGTTGTCATCATGATGGGG + Intronic
1175239278 20:57534647-57534669 GCAGTGGTGTCATCGTGGTTCGG - Intergenic
1175961232 20:62637490-62637512 ACAGAGGTGTCAGCTTGGTGGGG + Intergenic
1177113815 21:17061400-17061422 GCTGATTTTTCATGCTGGTGTGG - Intergenic
1179824468 21:43956423-43956445 GCAGTGATGGCATCCTGCTGGGG + Intronic
1180219018 21:46346264-46346286 GCACAGTGGGCATCCGGGTGGGG + Intronic
1181406350 22:22687453-22687475 GCAGAGTAGTCAGTCTGGAGTGG + Intergenic
1184593548 22:45501409-45501431 GGAGAGTGGTGATCCTGGAGTGG - Intergenic
952091537 3:29892775-29892797 GCAGAGATGTCATGCTACTGGGG - Intronic
953498850 3:43413326-43413348 GTTGAATTGTAATCCTGGTGGGG + Intronic
954325119 3:49859300-49859322 GCTGAGTAGGCAGCCTGGTGAGG - Exonic
954879724 3:53825107-53825129 GGAGTGTTGTCAGTCTGGTGGGG - Intronic
958424915 3:93968831-93968853 GGACAGTAGTCATCCTGGAGGGG - Intronic
962452028 3:135527938-135527960 CCAGTGTTGTCAAACTGGTGAGG - Intergenic
963206306 3:142639145-142639167 GCTCAGTTGTCATCCCTGTGTGG + Intronic
963857605 3:150271342-150271364 TCAGAGTGGTTATCCTAGTGGGG - Intergenic
964544881 3:157822836-157822858 ACAGAGTTTACATTCTGGTGGGG - Intergenic
969778217 4:9375390-9375412 GCAGAGTGGAAATACTGGTGAGG - Intergenic
973605989 4:52588339-52588361 GGGGAGGGGTCATCCTGGTGTGG - Intergenic
979475407 4:121151134-121151156 GAACACTTCTCATCCTGGTGTGG + Intronic
980761317 4:137238148-137238170 TCAGAGATGTCACCTTGGTGTGG + Intergenic
990469093 5:56097176-56097198 GCATATTTCTCATCATGGTGGGG + Intergenic
995513063 5:112927165-112927187 ACAGAGTTCTCATCATGGTTAGG + Intergenic
996141837 5:119920713-119920735 GAAGAGTGGTCATCCTTGTCTGG + Intergenic
996311012 5:122105195-122105217 GCAGATTTGCCATCCTAGGGTGG - Intergenic
997426962 5:133809830-133809852 GCAGTGGTGTCCTCCTGGTCTGG - Intergenic
999229243 5:150052069-150052091 ACAGAGCTGCCAGCCTGGTGAGG + Exonic
1002400154 5:178987025-178987047 GCAGAGCTGGCCTCCTGGGGAGG + Intronic
1006941725 6:37756176-37756198 GCAGAGGGGTCTTCCTGATGGGG - Intergenic
1007828246 6:44617852-44617874 TCAGACAAGTCATCCTGGTGAGG - Intergenic
1008318601 6:50078855-50078877 GTAGAGTTCTCATCCTTGTTGGG + Intergenic
1010523214 6:76867266-76867288 GGAGGGTTTTCATCCTTGTGAGG - Intergenic
1017611426 6:156190471-156190493 GTGGAGTTGTGCTCCTGGTGGGG - Intergenic
1019049330 6:169171058-169171080 ACAGAGATGTGATCCAGGTGGGG + Intergenic
1019995664 7:4722867-4722889 GCAGAATTGGCATCCAGGTGAGG + Intronic
1021523610 7:21561739-21561761 GCAGGGTTGTCATCTTTGGGTGG - Intronic
1023050196 7:36244616-36244638 GCCGAGTTCTCCTCCCGGTGTGG + Intronic
1024046786 7:45590614-45590636 ACAGAGCTGTCATCATGGTGTGG - Intronic
1024852797 7:53741089-53741111 GCAGAGATGGCATGCTGGTGGGG - Intergenic
1028482939 7:91327735-91327757 GAAATGTTGTCATCCTGGTCAGG - Intergenic
1029917485 7:104226624-104226646 ACAGAGATGTCAGCCTTGTGAGG - Intergenic
1036136161 8:6163494-6163516 GCACAGTGGTCTTCCTGTTGGGG + Intergenic
1036275674 8:7349387-7349409 GCAGAGTGGAAATACTGGTGAGG - Intergenic
1036841005 8:12121724-12121746 GCAGAGTGGAAATTCTGGTGAGG + Intergenic
1039098565 8:33914553-33914575 GCTGAGTGGTAAGCCTGGTGTGG - Intergenic
1040040132 8:42907757-42907779 GCAGAGTCGACATCCTTGTCTGG - Intronic
1040879561 8:52190656-52190678 GCAGAGCTGTGATCTTGCTGAGG + Intronic
1044189213 8:89294862-89294884 GCAGAGTTCTGTTTCTGGTGTGG - Intergenic
1044815380 8:96107390-96107412 ACAGAGTTGACATTCTGGCGGGG + Intergenic
1048190383 8:132282799-132282821 GCAGGGTTGCCCTCCTGATGGGG + Intronic
1049285891 8:141775008-141775030 GCAGAGAAGTCAGCCTGGGGAGG + Intergenic
1057127757 9:92632677-92632699 GCAGAGTTGTCATCCTGGTGAGG - Intronic
1057267640 9:93629774-93629796 GCAGAGATGTCCTCCTGGAAAGG - Intronic
1059466043 9:114469506-114469528 GGAGGGTTGTGACCCTGGTGAGG - Intronic
1061856750 9:133445693-133445715 GCAGAGGTGGCATCCAGCTGTGG - Exonic
1061960013 9:133983163-133983185 ACAGCGTTGGCAACCTGGTGGGG - Intronic
1186197169 X:7121026-7121048 GAAGATTTGTCATCTGGGTGTGG + Intronic
1187367319 X:18675747-18675769 GCAGAGTATTCAACCTGGTGCGG + Intergenic
1187412435 X:19062891-19062913 GCAGAGTTGTCTTCCTCATTTGG - Intronic
1190765567 X:53473115-53473137 AGAGAGGTGTCATTCTGGTGGGG + Intergenic
1190995660 X:55606180-55606202 TCAGAGATGTCTTCCTAGTGAGG + Intergenic
1191693250 X:63962359-63962381 GCAGAGTTTTCATTCCGTTGGGG - Intergenic
1192192757 X:69002603-69002625 CCAGAGTACACATCCTGGTGGGG + Intergenic
1196024121 X:111021662-111021684 GCAGAGATTTCATCTTGGTTTGG - Intronic
1200162081 X:154014844-154014866 ACAGAGCTGACTTCCTGGTGGGG + Intronic