ID: 1057128490

View in Genome Browser
Species Human (GRCh38)
Location 9:92637650-92637672
Sequence CCCGGGGGACAGGTTTTCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057128490_1057128498 -2 Left 1057128490 9:92637650-92637672 CCAAGGAAAACCTGTCCCCCGGG No data
Right 1057128498 9:92637671-92637693 GGTTGCAATGAGGATCCAACAGG No data
1057128490_1057128499 11 Left 1057128490 9:92637650-92637672 CCAAGGAAAACCTGTCCCCCGGG No data
Right 1057128499 9:92637684-92637706 ATCCAACAGGATATATAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057128490 Original CRISPR CCCGGGGGACAGGTTTTCCT TGG (reversed) Intronic