ID: 1057128563

View in Genome Browser
Species Human (GRCh38)
Location 9:92637967-92637989
Sequence CCTTCCCCAGGTAGGCGGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 227}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057128563_1057128577 16 Left 1057128563 9:92637967-92637989 CCCCACCGCCTACCTGGGGAAGG 0: 1
1: 0
2: 0
3: 13
4: 227
Right 1057128577 9:92638006-92638028 CAGCGAAGGCTCCTACTGAAAGG 0: 1
1: 0
2: 0
3: 7
4: 57
1057128563_1057128578 17 Left 1057128563 9:92637967-92637989 CCCCACCGCCTACCTGGGGAAGG 0: 1
1: 0
2: 0
3: 13
4: 227
Right 1057128578 9:92638007-92638029 AGCGAAGGCTCCTACTGAAAGGG 0: 1
1: 0
2: 1
3: 4
4: 90
1057128563_1057128572 -7 Left 1057128563 9:92637967-92637989 CCCCACCGCCTACCTGGGGAAGG 0: 1
1: 0
2: 0
3: 13
4: 227
Right 1057128572 9:92637983-92638005 GGGAAGGCTGGGCCCTACCTTGG 0: 1
1: 0
2: 0
3: 23
4: 295
1057128563_1057128573 2 Left 1057128563 9:92637967-92637989 CCCCACCGCCTACCTGGGGAAGG 0: 1
1: 0
2: 0
3: 13
4: 227
Right 1057128573 9:92637992-92638014 GGGCCCTACCTTGGCAGCGAAGG 0: 1
1: 0
2: 0
3: 8
4: 75
1057128563_1057128579 21 Left 1057128563 9:92637967-92637989 CCCCACCGCCTACCTGGGGAAGG 0: 1
1: 0
2: 0
3: 13
4: 227
Right 1057128579 9:92638011-92638033 AAGGCTCCTACTGAAAGGGCTGG 0: 1
1: 0
2: 1
3: 6
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057128563 Original CRISPR CCTTCCCCAGGTAGGCGGTG GGG (reversed) Intronic
900300164 1:1973169-1973191 CCTCCCCAAGGGAGGCTGTGCGG - Intronic
901794918 1:11674592-11674614 CCTCCCCCAGGAGGGCAGTGAGG - Exonic
902835485 1:19044326-19044348 CCCTTCCCAAGAAGGCGGTGGGG - Intergenic
903320260 1:22538918-22538940 CCTTCCCGAGGTCAGCAGTGGGG - Intergenic
903970792 1:27117551-27117573 CCCTCCCCAGGCAGGAGCTGTGG - Intronic
905240277 1:36576706-36576728 CTTTCCCCAGGAAGCCGGAGAGG + Intergenic
907158332 1:52354182-52354204 ACTTCCCCAGGCAGGCAGTAGGG + Intronic
909658339 1:78055297-78055319 CCGTCACCTGGTAGGAGGTGGGG + Intronic
912624954 1:111199147-111199169 CCTTCACCAGGTAGAGGGTTGGG - Intronic
915164658 1:153941869-153941891 GCTTCCAAGGGTAGGCGGTGGGG + Exonic
915892164 1:159782374-159782396 CCTTCCCCATGTTGTCGATGGGG + Exonic
916472534 1:165138129-165138151 CCTGCACCAGGTAGACAGTGAGG - Intergenic
919077145 1:192827288-192827310 CCCTACCCAGATAGGAGGTGTGG - Intergenic
919539294 1:198828675-198828697 TCTTCTCCAGGAAGGCAGTGGGG + Intergenic
920006426 1:202836693-202836715 CCTGCCCCAGGTAGGTGGGGAGG + Intergenic
920195518 1:204223660-204223682 CCCTCCCCAGGCAGGGAGTGAGG + Intronic
921295054 1:213693604-213693626 CCTTCCTCAGGCAGGCAGGGTGG - Intergenic
1065020881 10:21500776-21500798 CCTTGGCCAGGTAGCAGGTGAGG - Intergenic
1069634844 10:69918838-69918860 TCTTCCCCAGGTGAGGGGTGTGG - Intronic
1072742962 10:97921271-97921293 CCTGCCCCAGGTAGGGGCTATGG + Intronic
1073374482 10:103021233-103021255 CCTTCGTCAGGGAGGCTGTGGGG - Intronic
1073458080 10:103649835-103649857 CTTCCCCCAGGAAGGGGGTGAGG - Intronic
1074454471 10:113585540-113585562 CTTTCCCCAGGTAGGCCATGAGG - Intronic
1077013131 11:388355-388377 CATCCCCCAGGAAGGCAGTGGGG - Intergenic
1077014735 11:394515-394537 ACTGCCAGAGGTAGGCGGTGGGG + Exonic
1077485309 11:2835795-2835817 CCTTCCTCATGGAGGCGGCGGGG + Intronic
1078144274 11:8712474-8712496 CCTTCCCCAGATAGGCCTGGCGG + Intronic
1078590480 11:12636925-12636947 CATTCCCCAGGCAGACTGTGAGG + Intergenic
1079094313 11:17501114-17501136 CCTGGCCCTGGAAGGCGGTGTGG - Exonic
1081616820 11:44596183-44596205 GCTTCCCCAGCTTGGCGGTCAGG + Intronic
1081706418 11:45184426-45184448 CTTTCCCCAGGTAGAGCGTGTGG + Intronic
1083347039 11:62001031-62001053 CCTGGCCCAGGTGGGCGGTCCGG - Intergenic
1084321719 11:68377101-68377123 CACTCCCCAGGCAGGCAGTGGGG - Intronic
1085557851 11:77441561-77441583 CCTTACCCAGGTAGCTTGTGAGG + Intronic
1087642725 11:100772593-100772615 CCTTCCCCAGCTCTGCTGTGAGG - Intronic
1088538088 11:110883747-110883769 CCCTCCCCAGGAAGGAGTTGAGG + Intergenic
1088908006 11:114169389-114169411 TCTTCCCCAGGCACGCGCTGGGG + Intronic
1089497201 11:118913808-118913830 CCCTCCCCAGGTAGGGTCTGGGG - Intronic
1089601096 11:119615816-119615838 CCCTCCCCAGATAGGCGCTGGGG - Intergenic
1090799637 11:130162188-130162210 CCTTCCCAAGGCTGGTGGTGTGG + Intronic
1097446510 12:59678727-59678749 CCTTCCCCAGCTTGAAGGTGGGG + Intronic
1098290867 12:68955942-68955964 CCGTCCCCAGCTTGGAGGTGGGG + Intronic
1102040825 12:109799670-109799692 CCTTCCCCAGCTGTGCAGTGGGG - Intronic
1102241137 12:111325572-111325594 CTTTTCCCAGGTAGGCTCTGGGG - Intronic
1104332502 12:127860319-127860341 CACTCACCAGGTGGGCGGTGAGG + Intergenic
1104815595 12:131643824-131643846 CCATCCCCAGGTGGTGGGTGGGG + Intergenic
1105303804 13:19155727-19155749 CCTGCCCAAGGTGGGCTGTGTGG - Intergenic
1106792335 13:33168385-33168407 GCTTCCCCAGGCAGGTGGTCCGG - Intronic
1106850260 13:33782506-33782528 CCCTTCCCAGGTTGGAGGTGGGG - Intergenic
1112593213 13:100783418-100783440 CCTTCCCCAAGTTGGAGGTTTGG - Intergenic
1116560178 14:46368575-46368597 CCTTCCCCAAGGAAGGGGTGAGG - Intergenic
1117920330 14:60721859-60721881 CCTTCCGCAGATATGCGGAGAGG - Intronic
1119194133 14:72704520-72704542 CCTACCTCAGGCAGGGGGTGGGG - Intronic
1120961464 14:90128895-90128917 CCGTCCTCAGGTTGGCGGTGGGG - Intronic
1121262429 14:92576125-92576147 GCTTCCCCAGGAAGGGGGAGGGG - Intronic
1121365324 14:93303833-93303855 CCTTCCTCTGGTGGGGGGTGGGG - Intronic
1121446589 14:93982712-93982734 CCTTCGCCAGGGATGCGCTGTGG + Intergenic
1123033249 14:105460995-105461017 CCATCTCCAGGTAGGCTGCGGGG + Intronic
1124264763 15:28222704-28222726 CATTCCCTAGGTAGTAGGTGTGG + Intronic
1124820835 15:33044308-33044330 CCTTCCCCAGCTTGAAGGTGGGG - Intronic
1126676818 15:51166759-51166781 CCTTCCCCAGGTGGCTGGTTTGG - Intergenic
1131133132 15:89912739-89912761 CCTACCCCTGGTGGGCGGCGGGG + Exonic
1134811146 16:17167901-17167923 CCTCCCCCAGATAAGCCGTGGGG - Intronic
1136295125 16:29297302-29297324 TCTTCCCCAGGGAGGGGGTTAGG + Intergenic
1137709427 16:50555957-50555979 CCTTCCTCAGGGAGAGGGTGGGG - Intronic
1139634465 16:68249551-68249573 CCTTCCCCAGGTCCTCGGTCTGG + Intronic
1139698404 16:68691940-68691962 CCATCCTCAGGGAGGGGGTGGGG - Intronic
1145921606 17:28614074-28614096 CCCTCACAAGGTAGGCTGTGGGG - Exonic
1145936374 17:28717200-28717222 GCTGCCCCAGGTAGGCGCCGGGG - Exonic
1146006409 17:29163362-29163384 TCTCACCCAGGTAGGTGGTGGGG - Intronic
1146635839 17:34503875-34503897 ACTTCGCCAGGCAGGCGCTGGGG + Intergenic
1146916900 17:36683686-36683708 CCTTCCCCAGAGAAACGGTGGGG - Intergenic
1147497974 17:40936336-40936358 CCTTCTCCAGGTAGGAGGCCAGG + Exonic
1147556195 17:41480755-41480777 CCTTCTCCAGGTAGCCGGCCAGG + Exonic
1147741921 17:42674863-42674885 CCTTGGCCAGGGAGGCAGTGTGG - Intronic
1150168312 17:62966075-62966097 CCTTCCACAGTTTGGGGGTGGGG - Intergenic
1150643223 17:66963626-66963648 CCTTCTCCAGGGAGCCGGTCCGG - Intergenic
1151539704 17:74758766-74758788 CCTGCCCCAGCTTGGCGGTGAGG + Intronic
1151828171 17:76535180-76535202 ACTTCTCCAGGTTGGGGGTGTGG + Intronic
1151988343 17:77558166-77558188 CCCTCCCCAGGTGGAAGGTGAGG + Intergenic
1152418913 17:80181552-80181574 CCTGGCGCAGGTAGGGGGTGAGG - Exonic
1152461662 17:80445150-80445172 CCTTCCCCAGGGAGTCAGGGAGG + Intergenic
1152530823 17:80918136-80918158 CGTTCCCCAGGTCTGCAGTGAGG - Intronic
1152736071 17:81997414-81997436 CCCTGCTCAGGTAGGAGGTGGGG - Intronic
1153238726 18:3012737-3012759 CCATCCCCAGGGCGGCGGCGAGG + Intronic
1153815166 18:8784801-8784823 CCTTCCCCAGGTTCCCGATGGGG - Exonic
1154201614 18:12304569-12304591 CCTTCCCCAGCGAGGCAGTGGGG + Intergenic
1157275005 18:46304160-46304182 CCTTGCCCAGGGAGGAGGTAGGG + Intergenic
1157695173 18:49716679-49716701 CCTTCCCAAGGGAAGCTGTGAGG - Intergenic
1160663959 19:314239-314261 CCTGCCCCCGGTAGCTGGTGTGG + Intronic
1160770916 19:830698-830720 CCTTCCCCAGCTGGACCGTGAGG + Exonic
1160792500 19:929182-929204 CCTTCCCCATGAAGGCCCTGGGG - Intronic
1161188457 19:2939030-2939052 CCTTACCCAAGGAGGCAGTGAGG + Intronic
1161188465 19:2939065-2939087 CCTTACCCAAGGAGGCAGTGAGG + Intronic
1161188474 19:2939100-2939122 CCTTACCCAAGGAGGCAGTGAGG + Intronic
1161188483 19:2939135-2939157 CCTTACCCAAGGAGGCAGTGAGG + Intronic
1161188492 19:2939170-2939192 CCTTACCCAAGGAGGCAGTGAGG + Intronic
1161188501 19:2939205-2939227 CCTTACCCAAGGAGGCAGTGAGG + Intronic
1161188510 19:2939240-2939262 CCTTACCCAAGGAGGCAGTGAGG + Intronic
1161993461 19:7698472-7698494 CCATCCCCAGCTGGGAGGTGGGG - Intronic
1162034912 19:7933558-7933580 TCTTCCCCAGGGAGGCCCTGGGG - Exonic
1162561963 19:11422272-11422294 GCTTCCCCAGGGAGGTGGGGCGG + Intronic
1163157854 19:15449208-15449230 CCCTCCCCAGGGAGATGGTGGGG + Intronic
1164752920 19:30669510-30669532 ACTTCCGCAGGCAGGCGGAGGGG + Intronic
1164916055 19:32053143-32053165 TCTTCCCAAGGGAGGCTGTGGGG + Intergenic
1165994225 19:39833254-39833276 CCTGACCCGGGTAGGGGGTGGGG - Exonic
1166280239 19:41787753-41787775 CCTCCCCCAGGAAGGAGGTCAGG - Intergenic
1166412475 19:42565185-42565207 CCTCCCCCAGGAAGGAGGTCAGG + Intergenic
1167146065 19:47681267-47681289 CCTGCCCCAGGTAAGCAGGGCGG + Exonic
1167685433 19:50952952-50952974 TGTCCCCCAGGTAGGGGGTGGGG + Exonic
927917148 2:26944679-26944701 CATCCCCCAGGTAGGGAGTGCGG - Exonic
928241310 2:29589257-29589279 CCTTCTCCAGGTAGGAGATGGGG + Intronic
932234821 2:70112525-70112547 CTTTCCCCAGGGAGGCTTTGGGG + Intergenic
933833748 2:86230120-86230142 CATGCCCCAGGGAGGCAGTGGGG - Intronic
936977976 2:118238166-118238188 CCTTTCCCAGGCATGCAGTGAGG + Intergenic
938091927 2:128440083-128440105 CCTCCCCCAGGAAGGTGGTTTGG + Intergenic
938258913 2:129881373-129881395 CCTCCACCAGGTAGGGTGTGGGG + Intergenic
941905186 2:170713064-170713086 CCTTTCCCAGGGAGGCGGGCAGG - Exonic
942047115 2:172106284-172106306 CCTGCCCCAGGCTAGCGGTGGGG - Intergenic
942292480 2:174486691-174486713 CGTTCCACAGGCAGGCGCTGCGG + Intronic
944540779 2:200751506-200751528 CTTTCCACAGGTAGTCTGTGTGG + Intergenic
945848774 2:214980566-214980588 CCTGCTCCAGGAAGGCGATGCGG + Exonic
946203945 2:218089883-218089905 ACTTCCCCAAGTGGGCGCTGAGG - Exonic
948677158 2:239603306-239603328 CCTGCCCCAGGTGCACGGTGAGG - Intergenic
1169384203 20:5134204-5134226 CCTTACCCAGGCAGTGGGTGAGG + Intronic
1171959877 20:31485826-31485848 CCTTCCCCAGGCTGGGGTTGGGG - Intergenic
1174506662 20:51021932-51021954 CCTTCTCAAGGTGGGAGGTGTGG - Intronic
1175826340 20:61938497-61938519 GCTTCCCGAGGAAGGAGGTGAGG + Exonic
1176310075 21:5144826-5144848 CCTTCCCCAGGGCGGGGTTGGGG + Intronic
1178582212 21:33846702-33846724 TCCTCCCCAGCTAGGCTGTGAGG + Intronic
1178608209 21:34057551-34057573 CCTACCCCAGGGAGGGGGTCTGG - Intergenic
1179846981 21:44117206-44117228 CCTTCCCCAGGGCGGGGTTGGGG - Intronic
1181000129 22:19984210-19984232 TCTTCCCTAGCTAGGCAGTGGGG + Intronic
1181112020 22:20607778-20607800 TTCTCCCCAGGTAGGCTGTGTGG - Intergenic
1181570167 22:23764130-23764152 TCTGCCTCAGGTGGGCGGTGAGG - Exonic
1181939535 22:26464555-26464577 CCTTCCCCAGGGAGGAGCTGAGG + Exonic
1184290918 22:43497781-43497803 CCTCCCCCAGGTGGGGTGTGTGG - Intronic
1184565431 22:45288992-45289014 CCACCCACAGGGAGGCGGTGGGG - Intronic
1184677771 22:46053091-46053113 CCTTCCCCAGGCAGCATGTGAGG + Intronic
1184907338 22:47497764-47497786 CCTGCCCCAAGTAGGCCCTGAGG - Intergenic
1185167354 22:49269914-49269936 GCTTCCCCGGGAAAGCGGTGCGG - Intergenic
950194765 3:11001348-11001370 GCTTCCCCAAGAAGGAGGTGCGG + Intronic
950506054 3:13395209-13395231 TTCTCCCCAGGTAGGTGGTGGGG - Intronic
950555003 3:13690042-13690064 CCTCCCCCAGGCAGGAGGGGAGG - Intergenic
950673415 3:14540374-14540396 CCCTCCCCAGGGAGGGGCTGTGG + Exonic
953383686 3:42492794-42492816 CCTTCCTGAGGTGGGAGGTGGGG - Intronic
953704703 3:45222186-45222208 GGTGCCCCAGGTAGGAGGTGCGG + Intergenic
953802027 3:46031640-46031662 CCTTCCCCAGCTTGAAGGTGGGG - Intergenic
954583618 3:51716895-51716917 CCTTCCCCAGGACAGAGGTGTGG + Intronic
954591852 3:51789728-51789750 CCATCTCCATGTAGGAGGTGTGG + Intergenic
955360486 3:58269776-58269798 CCCTCCCCAGCTAGGCAGAGGGG - Intronic
955498874 3:59564314-59564336 AATTCCTCAGGTAGGAGGTGGGG + Intergenic
956765777 3:72483050-72483072 CCTTCCCGAGGTGAGGGGTGGGG + Intergenic
962164955 3:133038719-133038741 CCCTCCCCAGGTGGAGGGTGCGG + Intronic
966823081 3:183940530-183940552 CCTTTCCCAGATAGGAGGGGAGG + Intronic
968202046 3:196763066-196763088 TCTTTCCCAGGCAGGGGGTGGGG - Intronic
968907832 4:3462828-3462850 CCCTCCCCAGGCAGGCAGTAGGG - Intergenic
968921063 4:3522568-3522590 ACTTCCCCAGGCAGGGAGTGTGG - Intronic
968921075 4:3522602-3522624 TCCTCCCCAGGCAGGGGGTGTGG - Intronic
968921088 4:3522636-3522658 TCCTCCCCAGGCAGGGGGTGTGG - Intronic
968921102 4:3522670-3522692 TCCTCCCCAGGCAGGGGGTGTGG - Intronic
968921115 4:3522704-3522726 TCCTCCCCAGGCAGGGGGTGTGG - Intronic
970244541 4:14045985-14046007 CCTTCCCCAGTTAAGCCTTGGGG + Intergenic
971853095 4:32009985-32010007 CCCTCCCCAGGGAGGCAGTGAGG + Intergenic
978323037 4:107519229-107519251 CCTCCCACAGGGAGGCAGTGTGG - Intergenic
984639587 4:182146065-182146087 ACTTCTCCAAGTAGGCAGTGGGG - Intronic
985129642 4:186726713-186726735 CCTCCCCCTTGGAGGCGGTGGGG + Intronic
986264584 5:6181151-6181173 CCTTCCTCAGGATGGAGGTGAGG - Intergenic
987072974 5:14355132-14355154 CCTTCCACATGCAGGTGGTGGGG - Intronic
987129848 5:14850227-14850249 CCTTCCCCACCCAGGCAGTGGGG - Intronic
992105414 5:73446719-73446741 CCTACCCCAGGTCGGGGGTTGGG + Exonic
993020518 5:82585252-82585274 CCCACCCCAGGGAGGTGGTGAGG - Intergenic
993703360 5:91143727-91143749 CCTTCCCCAGCTTGAAGGTGGGG + Intronic
993827613 5:92711101-92711123 CCTTCCCCAGCAAAGCTGTGTGG - Intergenic
994431757 5:99674269-99674291 CCTTCCCCAGCCAGCTGGTGGGG + Intergenic
998320545 5:141225560-141225582 CCACCACCAGGTAGACGGTGAGG - Exonic
998321555 5:141236609-141236631 CCACCACCAGGTAGACGGTGAGG - Intergenic
1001308141 5:170590620-170590642 TCCTCCCCAGTTAGGTGGTGAGG - Intronic
1001315052 5:170636049-170636071 TCTTCCCCAGGTGGGTGTTGAGG - Intronic
1001986156 5:176075686-176075708 CCTTCCCAGGGTAGACTGTGGGG - Intronic
1002082841 5:176747815-176747837 CCTTTCCCAGGCAGCTGGTGAGG + Intergenic
1002230713 5:177762438-177762460 CCTTCCCAGGGTAGACTGTGGGG + Intronic
1002264623 5:178021310-178021332 CCTTCCCAGGGTAGACTGTGGGG - Intronic
1003684412 6:8287047-8287069 CCTTTCCCAGGTAGGAAGTGAGG - Intergenic
1005207374 6:23420465-23420487 CCTGCCCCAGGCATGCAGTGGGG - Intergenic
1006453625 6:34119886-34119908 CCTACCCCAGGCCTGCGGTGAGG + Intronic
1006513643 6:34534486-34534508 CTTTCCCCAGGCAGGAGTTGGGG + Exonic
1006513654 6:34534524-34534546 CCTTTCCAAGGTAAGCGATGAGG - Exonic
1007080915 6:39103198-39103220 CCTGCCCAAGGTTGGGGGTGGGG + Intergenic
1009290077 6:61870034-61870056 CCCTCCCCAGGAAAGGGGTGGGG + Intronic
1010794750 6:80106421-80106443 CCTCCCCGAGGTCGGCCGTGCGG - Intergenic
1010926842 6:81753946-81753968 GCTCCCCCAGTTAGGAGGTGCGG - Intergenic
1014466671 6:121764404-121764426 CCTTCCTCAAGTAGGCCCTGGGG - Intergenic
1017129431 6:151095278-151095300 CATTCCCCAGTAAGGCTGTGGGG + Intronic
1019635169 7:2071616-2071638 CCTTCCCCAGCTTAGGGGTGGGG - Intronic
1019648124 7:2141794-2141816 CCTTCCCCAGGCTGTCTGTGCGG - Intronic
1023688899 7:42765434-42765456 CATGTCCCAGGCAGGCGGTGGGG - Intergenic
1023872478 7:44270233-44270255 CCCTCCCCAGCTGGGCTGTGTGG - Intronic
1025204707 7:56985510-56985532 CTTTCCCCAGGAGGGTGGTGTGG - Intergenic
1025667230 7:63591425-63591447 CTTTCCCCAGGAGGGTGGTGTGG + Intergenic
1029355664 7:100049787-100049809 CGGTCCCGAGGTACGCGGTGCGG + Exonic
1029413718 7:100430430-100430452 CCCCCCCCAGGTGGCCGGTGGGG - Exonic
1032011592 7:128351248-128351270 CGGTCCCCAGCGAGGCGGTGCGG + Exonic
1032078734 7:128848325-128848347 CATTCCCCAGGAAGGTGCTGTGG - Intronic
1034210421 7:149358200-149358222 CCTTCCCCAGCTTGAAGGTGGGG + Intergenic
1034554237 7:151839833-151839855 CCTTCCCCAGGGACACCGTGTGG + Intronic
1035277098 7:157754168-157754190 CCTTCCCGAGGAAGCCTGTGGGG + Intronic
1037902431 8:22695537-22695559 CGTCACCCAGGGAGGCGGTGGGG + Intergenic
1037959291 8:23084205-23084227 CCTTCCCCAGAGCGGCGGTGGGG + Intergenic
1039576657 8:38629092-38629114 CCATTTCCAGGTAGGAGGTGGGG - Intergenic
1039816659 8:41100523-41100545 CCTTTCCCAGGGAGGCTGGGTGG + Intergenic
1042288726 8:67144734-67144756 CATTTCCCAGCTAGGCGATGTGG - Intronic
1048295818 8:133212621-133212643 CCTTCCGCTGGTCAGCGGTGGGG - Intronic
1049275687 8:141719038-141719060 CCTTCCCCAGTTGTGAGGTGGGG - Intergenic
1049663944 8:143834845-143834867 GCTGCCCCAGGGAGGAGGTGCGG + Exonic
1049796916 8:144501119-144501141 TCCTCCCCAGGAAGGTGGTGAGG + Exonic
1052817438 9:33112316-33112338 CCCTCCCCAGGTGGGCAGGGCGG - Exonic
1053164803 9:35836792-35836814 GCTTCCCCAGGTGTGTGGTGAGG + Intronic
1053270526 9:36746355-36746377 CTTTCCCCAGGTGGGGGCTGGGG - Intergenic
1056722418 9:89083119-89083141 CCTTCCCCATGGAGGCAGGGTGG - Intronic
1056817361 9:89811637-89811659 CCCTCCCCAGGTATGAGGTGTGG + Intergenic
1056860000 9:90172249-90172271 CCTTCCCCAGGTATTTGCTGAGG - Intergenic
1057128563 9:92637967-92637989 CCTTCCCCAGGTAGGCGGTGGGG - Intronic
1058619780 9:106870809-106870831 CCTTCCCCAGCTGGGCTCTGTGG - Intronic
1059284447 9:113160691-113160713 CCTTCCAGAGGTAGGGAGTGGGG + Intronic
1059414664 9:114155548-114155570 CCTCCCCCAGGCCGGCGGGGAGG + Exonic
1060655486 9:125369747-125369769 ACCTCCCCAGGTGGGCGATGAGG - Intergenic
1061423096 9:130482780-130482802 CTTTCCCCAGGTGGGTGGTAAGG - Intronic
1061667977 9:132171319-132171341 CCTCTCCCAGGAAGTCGGTGAGG - Intronic
1061939640 9:133877047-133877069 CTTTCCCCAGGTGGGTGGGGAGG - Intronic
1062012020 9:134272458-134272480 CCCTTCCCAGGTGGGCTGTGAGG + Intergenic
1062373493 9:136252079-136252101 CCTTCCCCTGGTGGACGGGGTGG - Intergenic
1062373600 9:136252365-136252387 CCTTCCCCTGGTGGACGGGGTGG - Intergenic
1185611573 X:1396485-1396507 CCTTTCCCAAGGAGGCTGTGTGG - Intergenic
1185784735 X:2881144-2881166 CCTTCCCCATGTAGTCGATACGG - Exonic
1185880314 X:3734439-3734461 CCTTGCCCAGCTAGGAGGTCAGG + Intergenic
1187486792 X:19711712-19711734 CGTTCCCCAGGTATGTGGTAAGG - Intronic
1188870717 X:35367594-35367616 CCTTCCCCATGCAGCAGGTGAGG - Intergenic
1192067879 X:67904896-67904918 CCTTGCCCAGGTAAGTGGTGAGG - Intergenic
1198736553 X:139792090-139792112 CCTTCCCCAGGTCAGGTGTGGGG - Intronic
1200059359 X:153477331-153477353 CCATCCCCAGGCAGGGGGAGGGG + Intronic