ID: 1057130598

View in Genome Browser
Species Human (GRCh38)
Location 9:92651662-92651684
Sequence AGGGAGGAGCTGGAGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2113
Summary {0: 1, 1: 1, 2: 11, 3: 309, 4: 1791}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057130598_1057130604 -6 Left 1057130598 9:92651662-92651684 CCCTCCACCTCCAGCTCCTCCCT 0: 1
1: 1
2: 11
3: 309
4: 1791
Right 1057130604 9:92651679-92651701 CTCCCTCATGTTGTTTTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057130598 Original CRISPR AGGGAGGAGCTGGAGGTGGA GGG (reversed) Intronic
Too many off-targets to display for this crispr