ID: 1057132089

View in Genome Browser
Species Human (GRCh38)
Location 9:92661339-92661361
Sequence CTGAGAACCTCCCAGGGTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 393
Summary {0: 1, 1: 1, 2: 4, 3: 46, 4: 341}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057132089_1057132097 25 Left 1057132089 9:92661339-92661361 CCTGGACCCTGGGAGGTTCTCAG 0: 1
1: 1
2: 4
3: 46
4: 341
Right 1057132097 9:92661387-92661409 GCTGCTACTGAGTCACCAGCAGG No data
1057132089_1057132094 -4 Left 1057132089 9:92661339-92661361 CCTGGACCCTGGGAGGTTCTCAG 0: 1
1: 1
2: 4
3: 46
4: 341
Right 1057132094 9:92661358-92661380 TCAGCGTCTTTCTGGTGGCCAGG No data
1057132089_1057132093 -9 Left 1057132089 9:92661339-92661361 CCTGGACCCTGGGAGGTTCTCAG 0: 1
1: 1
2: 4
3: 46
4: 341
Right 1057132093 9:92661353-92661375 GGTTCTCAGCGTCTTTCTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057132089 Original CRISPR CTGAGAACCTCCCAGGGTCC AGG (reversed) Intronic
900192644 1:1358030-1358052 CTGGGAAGCTCCCAGGCTCTCGG - Intronic
900783723 1:4634334-4634356 CTGAGCATATCCCAGGGTCCCGG - Intergenic
901080350 1:6580409-6580431 CTGACAGCCTCCCGGGGGCCGGG - Intronic
901184022 1:7360608-7360630 ATGAGCACCTCCCATGCTCCTGG - Intronic
901744101 1:11361191-11361213 CTGAGAACCTTTCTGGGTCAAGG + Intergenic
902711990 1:18246767-18246789 TTGGGAGCCTCCCAGGATCCCGG + Intronic
902711994 1:18246778-18246800 CTGAGGACTTCCCGGGATCCTGG - Intronic
902754629 1:18540934-18540956 CTGAGAGCCCCCCATGGACCAGG - Intergenic
903175375 1:21577337-21577359 CTGAGAGCCTGCCAGGGGCCTGG - Intronic
903541527 1:24099033-24099055 CTGAGTTCCTCCCAGGTGCCAGG - Intronic
904648154 1:31983964-31983986 AAGAGAACCTTCTAGGGTCCTGG + Intergenic
905132705 1:35772989-35773011 CTTAGAACATCCCAGGTTCAAGG + Intergenic
905823744 1:41014242-41014264 CTGAGCACCTTCCACGGTCCAGG - Intergenic
905825033 1:41020771-41020793 CTGTGTACCTCCCAGGAGCCGGG - Exonic
906033868 1:42739087-42739109 CTGAGCACCCCCCAGGGCCCAGG - Intronic
906847152 1:49205504-49205526 GTGAGACCAACCCAGGGTCCAGG - Intronic
906943048 1:50272681-50272703 CTGAGCACCTCCCAGTCTCTGGG - Intergenic
907470886 1:54672805-54672827 CTGAGAATCTACCATGGACCAGG - Intronic
907885269 1:58587001-58587023 CTGAGTGCCTCCCAGGTGCCAGG + Intergenic
908285993 1:62602433-62602455 CTGAGAACCTCTTATGGACCAGG + Intronic
909350279 1:74644461-74644483 GTGAGAACCTTCCAGCTTCCAGG + Intronic
911525418 1:98979087-98979109 CTGAGTACCTCCCAGGTCCCAGG + Intronic
911924969 1:103817814-103817836 CTGAGTACCTCCCTGGGCCAGGG + Intergenic
912417733 1:109521485-109521507 CTGAGAACCTCCATGGCTCTGGG + Intergenic
912903986 1:113683943-113683965 CTTGGAACCTTCCAGGGCCCTGG - Exonic
914340067 1:146752787-146752809 CTGAGTACCTGCCAGGTGCCAGG + Intergenic
915338998 1:155166235-155166257 CTGAGAAACTTCCAGGCTGCTGG + Intergenic
915557373 1:156668182-156668204 CTGGGAGCCTCCCAGGGCCCAGG - Intergenic
915622258 1:157092892-157092914 CTAGGAGCCTCCCAGGGGCCTGG - Exonic
916260009 1:162832336-162832358 CTGAGGACCTCCTAGGTTCCAGG - Intronic
916528985 1:165638003-165638025 CTGAAAACCTACCATGGCCCGGG + Intronic
917633666 1:176915234-176915256 CTGAGGACCTACCATGGGCCAGG + Intronic
917750315 1:178047335-178047357 CTGAGTACCTGCCATGTTCCAGG - Intergenic
918042867 1:180923820-180923842 CTGAGAACACCCCAGGGCACGGG + Intronic
918395729 1:184111319-184111341 CAGAGCACAGCCCAGGGTCCTGG + Intergenic
919754368 1:201057545-201057567 CTGAGTACCTCCCATGTGCCAGG - Intronic
921179993 1:212624697-212624719 CTCAGAGCCTCCCAGAGGCCGGG - Exonic
922046037 1:221946919-221946941 CGGAGAGCCTCTCAGGGTACTGG - Intergenic
922608206 1:226904360-226904382 CTGCTCACCTCCCAGGGTCCTGG + Intronic
923043239 1:230334588-230334610 CTGAGAATCCCCCAGGGTGGGGG + Intronic
923335377 1:232965487-232965509 CTGAGCACCTCCTAGGAGCCAGG - Intronic
924268381 1:242306000-242306022 CTGAGAGTCTGCCTGGGTCCAGG - Intronic
924482138 1:244445619-244445641 CTAAGAAGCTCCAAAGGTCCAGG + Intronic
924599064 1:245472246-245472268 GTGAGAACCTCCCACGGGCAAGG - Intronic
1065001283 10:21339799-21339821 CTTAGGCCCTCCCAGAGTCCTGG + Intergenic
1065272900 10:24054444-24054466 CTTGGAATATCCCAGGGTCCTGG - Intronic
1067019860 10:42785878-42785900 CTTGGAACCTCCCAGAGTGCTGG - Intronic
1067753923 10:48989708-48989730 CTGAGCACGTCCCAAGTTCCAGG - Intergenic
1067958893 10:50825261-50825283 CTGAGAATTTCCCAGTCTCCTGG - Intronic
1069537458 10:69265526-69265548 CTGGGCACATCCCGGGGTCCTGG + Intronic
1069836549 10:71312813-71312835 CTGAGGTCCACCCAGGATCCAGG - Intergenic
1072417331 10:95260103-95260125 GTGAGCACCTACCAGGGGCCAGG + Intronic
1072624574 10:97102924-97102946 CTGAGCACTTGCCAGGGACCTGG - Intronic
1074723947 10:116288459-116288481 CTCAGAACTTTCCAGGTTCCTGG - Intergenic
1074884696 10:117684813-117684835 CTGGCAACCTGCCAGGGTCATGG + Intergenic
1075219243 10:120570123-120570145 TTGAGTACCTCCCATGGGCCAGG - Intronic
1075256567 10:120930270-120930292 CAGAGTAGCTCCCAGTGTCCTGG - Intergenic
1075687132 10:124371970-124371992 CTGATGGCCTCCCAGGGTTCAGG + Intergenic
1075782629 10:125026909-125026931 CTGTCCACCTTCCAGGGTCCTGG - Exonic
1076503112 10:130952426-130952448 CTGAGGACCTACCAGGGGCCTGG - Intergenic
1076841417 10:133047669-133047691 CTGAGAGCCTCGCACGGGCCGGG - Intergenic
1077333021 11:1991646-1991668 CTGAGACCCAGCCGGGGTCCAGG + Intergenic
1078477551 11:11644534-11644556 TTGAGAACCCCCCAGGGTTGTGG + Intergenic
1079869515 11:25780544-25780566 CTGAGAACCTTCCAGAGTCGGGG - Intergenic
1081646073 11:44791560-44791582 CTGAGTGCCTCCCAGTGCCCAGG - Intronic
1083310965 11:61783618-61783640 CTGAGGACCTCCCTGGGTGAGGG - Intronic
1084220619 11:67675401-67675423 CTGAGCACCTTCTAGGTTCCAGG + Intronic
1084691176 11:70727729-70727751 TAGAGGACCTCCCAAGGTCCCGG + Intronic
1084696044 11:70756175-70756197 CAGAGAACCTTCCAGACTCCAGG + Intronic
1084921530 11:72474647-72474669 CTCTGAACCTTCCAGGGTCATGG - Intergenic
1084962069 11:72721987-72722009 CTCAGACCCACCCAGGGGCCAGG - Intronic
1085279982 11:75323761-75323783 CTCTGAGCCACCCAGGGTCCAGG + Intronic
1087826259 11:102767993-102768015 CTGGGAGCCTCCCAGAGCCCAGG - Intergenic
1088747644 11:112817739-112817761 CTCAGAGGCTCCCAGGATCCAGG - Intergenic
1088985831 11:114907258-114907280 CTGAGAGCCTCCTATGTTCCAGG + Intergenic
1089859471 11:121575927-121575949 CTGAATTCATCCCAGGGTCCCGG + Intronic
1090531617 11:127596898-127596920 CTGAGTACTTGCCAGGGGCCTGG + Intergenic
1090951309 11:131475975-131475997 CTGAGTACCTGCCAAGTTCCAGG - Intronic
1202816004 11_KI270721v1_random:46824-46846 CTGAGACCCAGCCGGGGTCCAGG + Intergenic
1091487158 12:900536-900558 CTGGCAACATCCCAGAGTCCGGG + Exonic
1092387012 12:8043636-8043658 TTCAGAACCTCCCAGGGTTCTGG - Intronic
1094057661 12:26283257-26283279 CTGTGAACCCCCTAGGGGCCTGG - Intronic
1094327997 12:29260736-29260758 CTGTGGACCTACCTGGGTCCAGG + Intronic
1096479081 12:51926107-51926129 CTGAGAACCTTACTGGGTCCTGG + Intergenic
1096515351 12:52152477-52152499 CTGAGCCCCGCCCAGGGACCTGG + Intergenic
1097446712 12:59680256-59680278 CTGAGAGCTTCCAAGAGTCCTGG + Intronic
1100007448 12:89911244-89911266 CTGATCACCTCCCAGTGTGCTGG - Intergenic
1101592531 12:106137629-106137651 CTGACACCCTGCCAGGGTCCTGG - Intronic
1101839758 12:108319653-108319675 CTGAGAACATACCATGGGCCAGG - Intronic
1103601399 12:122056967-122056989 CTGAGAACCCACCATGGACCAGG + Intronic
1103855189 12:123963191-123963213 CTGAGAAACCCCCAGGGTTAGGG + Intronic
1104000204 12:124855331-124855353 CTCAGAAGCTCCCCAGGTCCCGG - Intronic
1104763119 12:131309928-131309950 CTGAGAAGCTCCCAGGCTGTGGG - Intergenic
1107050167 13:36038350-36038372 ATGAGAGCCTCCCAGGGGCAGGG + Intronic
1107812409 13:44213128-44213150 CTCAGATGCTCCCAGGGGCCCGG - Intergenic
1107836317 13:44414858-44414880 CTGGGAACCAGCCAGGGTCAGGG + Intergenic
1108681743 13:52786642-52786664 CTGAGAAGATCACAGGGTACAGG - Intergenic
1110792199 13:79598877-79598899 CTGAGAACCTGCCAGGTGGCAGG - Intergenic
1112943513 13:104895555-104895577 CTGAGAATCTACTAGGGTTCTGG - Intergenic
1113203282 13:107889837-107889859 CTGCGAAACTCTCAGGATCCAGG + Intergenic
1113838488 13:113345490-113345512 CTGCGAAGCCCCCAGGGTCTGGG - Intronic
1115094055 14:29613548-29613570 CTGAGTGCCTTCCAGGGGCCAGG + Intronic
1121557449 14:94849158-94849180 CTGAGGACCTCCCTGAGTCCAGG + Intergenic
1121645593 14:95515734-95515756 CTGGGACTCTCCCAGGTTCCTGG - Intergenic
1122048153 14:99038006-99038028 CTGAGCCTCTCCCAGGGCCCGGG + Intergenic
1122070891 14:99204623-99204645 CTGGACACCTCCCAGGGGCCAGG + Intronic
1122249267 14:100426755-100426777 CTGAGAACCTGCTAGGTGCCAGG + Intronic
1122977897 14:105178473-105178495 CTGAGTGCCACCCAGGGTGCAGG - Intronic
1123216372 14:106812923-106812945 CACAGAACCTCCCAAGGCCCAGG - Intergenic
1125523628 15:40361944-40361966 CTGGGAACCCCCCATGGCCCTGG + Intronic
1125610001 15:40963523-40963545 CTGAGCTCCTCCTAGGGCCCCGG - Intergenic
1126351390 15:47748364-47748386 CTGAGGACCTGCCAGGTGCCAGG + Intronic
1127060537 15:55178549-55178571 CTGAGCACCTTCTATGGTCCTGG + Intergenic
1127537823 15:59907074-59907096 CAGAAAACCTCCCTGGGTACTGG + Intergenic
1127904084 15:63363411-63363433 CTGAGCACCTCCCCTGGGCCAGG + Intronic
1128706159 15:69838619-69838641 CTGAGAACCTCCTGGGATCAAGG + Intergenic
1128996992 15:72304637-72304659 ATGAGAGCCTCCCTGGGTCAAGG - Intronic
1129249163 15:74299094-74299116 CTCAGAGCCTCCCAGAATCCCGG - Intronic
1130447825 15:84020407-84020429 CTGAGAACCTCCCAGGTGACAGG - Intronic
1130448038 15:84022449-84022471 CTGAGAACCTCCCAGGTGACAGG - Intronic
1130661230 15:85832944-85832966 TTGAGAACTTCCCGGAGTCCTGG + Intergenic
1131061858 15:89409401-89409423 CGGAGATCCTCCCAGAGCCCTGG + Intergenic
1131119745 15:89814800-89814822 CTCGGAACCCGCCAGGGTCCAGG - Exonic
1132331996 15:101018718-101018740 CAGAGAACCTCCCAGGGGCGCGG - Intronic
1132645741 16:998534-998556 GTGAGGACCTGCCAGGGTCATGG - Intergenic
1132847613 16:2007630-2007652 CTGAGCACCTGCCAGGGGTCAGG + Intronic
1132940020 16:2501830-2501852 CTGAGAAGCCCCCTGGGTCCAGG - Exonic
1134203074 16:12214999-12215021 CTGATAACCCACCAGGGACCAGG - Intronic
1134552263 16:15143700-15143722 CTGAGAACTTCCCTGGGTGTGGG + Intergenic
1135552086 16:23406196-23406218 CTGAAAACCAGCCAGGCTCCGGG + Exonic
1135610183 16:23859566-23859588 CAGCTCACCTCCCAGGGTCCTGG + Intronic
1135734662 16:24921111-24921133 CTGAGCACCTCCCAGGTGCCAGG + Intronic
1135863744 16:26081416-26081438 CTGAGAATCTCCAAGGTGCCAGG + Intronic
1136643591 16:31589198-31589220 CTGAGAACCACACAGGGTAACGG - Intergenic
1136873020 16:33825155-33825177 CACAGAACCTCCCAAGGCCCAGG + Intergenic
1137466068 16:48710952-48710974 CTCAAACCCTCCCAGGGGCCAGG + Intergenic
1137594274 16:49713548-49713570 CTGAGAACCTGCCAGGGTGCGGG - Intronic
1139276954 16:65736642-65736664 CTGAGTACCTACCAAGGGCCAGG - Intergenic
1139994221 16:70964621-70964643 CTGAGTACCTGCCAGGTGCCAGG - Intronic
1140158066 16:72454895-72454917 CTGTGGACCTGCCTGGGTCCTGG - Intergenic
1141779566 16:86150630-86150652 CTGGGCACTTCCCAGGCTCCAGG - Intergenic
1142249638 16:88985492-88985514 CTGACAAGCTCCCAGGGTCAGGG - Intergenic
1142265909 16:89063895-89063917 CTGGGAAACTCCCAGGGGCCGGG - Intergenic
1203099152 16_KI270728v1_random:1290900-1290922 CACAGAACCTCCCAAGGCCCAGG - Intergenic
1143021591 17:3919535-3919557 CTGAGAAGCAGCCCGGGTCCAGG - Intergenic
1144196800 17:12902327-12902349 CTGAGAACCGAACAGGGTGCTGG - Intronic
1144235593 17:13257645-13257667 GTGAGAACCCCCCAGGTTACAGG - Intergenic
1145305044 17:21669350-21669372 CAGAGAAACTCCCTGGCTCCAGG - Intergenic
1146271719 17:31489287-31489309 CTTAGAACATCCCCAGGTCCTGG + Intronic
1146796003 17:35781474-35781496 TTGAGAACATCTCAGGGTCCAGG + Intronic
1146893493 17:36524337-36524359 CTGAGAACTTGCCAGGTTCTAGG - Intronic
1146906406 17:36621107-36621129 CTGAGCACCTGCCAGGCTCCAGG - Intergenic
1146950398 17:36901431-36901453 CTGAGAACCTGCCAGATGCCAGG + Intergenic
1147605444 17:41771594-41771616 CAGAAAACCTGCCTGGGTCCTGG - Intronic
1148750656 17:49944078-49944100 ATCAGAACCTCACAGGGGCCGGG - Intergenic
1149654551 17:58303323-58303345 CTGGGAGCCTGCCAGGCTCCGGG - Intronic
1150722768 17:67627529-67627551 CTGAGAACCTCCCAGCAACATGG - Intronic
1151193827 17:72417881-72417903 CTGAAAACCTCCAAGGTTCCTGG + Intergenic
1151718889 17:75844733-75844755 GTGAGAACCCCCCCGGGCCCAGG - Intergenic
1151836816 17:76587225-76587247 CCGAAAACCTCCCAGGGCCTGGG + Intergenic
1152551592 17:81033092-81033114 CGGAAAAGCTCCCACGGTCCTGG - Intergenic
1152736676 17:82000690-82000712 CTGTGAACCACCCCGGGTCTCGG - Intronic
1152780534 17:82225800-82225822 CAGGGAACCTTCCAGGGTCGGGG - Intergenic
1153640781 18:7155235-7155257 CTGAGGACCTCTCAGGGGCCAGG - Intergenic
1153827990 18:8895028-8895050 CTGAGGACCTGACAGGGTCCCGG + Intergenic
1154321875 18:13360847-13360869 CAGAAATTCTCCCAGGGTCCAGG - Intronic
1155802325 18:30123272-30123294 CTGAGAACCTGGCAGGGCACTGG - Intergenic
1155947878 18:31876828-31876850 TTGAGAACGTCCCAGGGACAAGG + Intronic
1155955240 18:31951363-31951385 CAGTGAACCTCCAGGGGTCCTGG + Intronic
1155990315 18:32272899-32272921 CTGAGAACCAACCAGGATGCCGG + Intronic
1156239844 18:35242654-35242676 CTCAGAGCCTCCCGGGGCCCAGG - Exonic
1160240503 18:77119234-77119256 CTCAGCACCCCACAGGGTCCTGG - Intronic
1160539226 18:79611377-79611399 CCCAGGACCTCCCAGGGTCAGGG + Intergenic
1160680442 19:409558-409580 CTGCCAGCCTCCCAGCGTCCTGG + Intergenic
1160738879 19:676949-676971 CTGAGAGCTTTCCCGGGTCCTGG + Intronic
1160900703 19:1426641-1426663 TCAAGAACCTCCAAGGGTCCAGG - Intronic
1160971035 19:1767891-1767913 CTGATCTCCTCCCAGGGCCCCGG + Intronic
1161061436 19:2217111-2217133 CTGAGCACCTCCCTGAGCCCGGG - Intronic
1161218679 19:3107760-3107782 CTGAGCACCCCTCAGGGCCCAGG + Intronic
1161323489 19:3652092-3652114 CTGGGAACCCCATAGGGTCCGGG - Intronic
1161585787 19:5104796-5104818 CTGAGACCTGCCCAGGGTCTGGG - Intronic
1162013777 19:7832639-7832661 CTAAGACCCTCGCAGGGACCTGG - Intronic
1162126353 19:8501611-8501633 CTGAGCACCTACCATGTTCCAGG - Intronic
1162253695 19:9469585-9469607 CTGAGAACTTCTCATGGACCAGG + Intronic
1163262777 19:16201182-16201204 CTGAGCACCTACTATGGTCCAGG + Intronic
1163330992 19:16637608-16637630 CTGAGACCCTCCCATGGTTGAGG + Intronic
1164450792 19:28362564-28362586 CTGAGCACCTCACAGAGGCCTGG - Intergenic
1164645969 19:29858919-29858941 AAGGGAGCCTCCCAGGGTCCCGG + Intergenic
1165100446 19:33435745-33435767 GTCAGAACCTCCCAGGGCCATGG + Intronic
1166709252 19:44926553-44926575 CTGAGGACCCCCCAGAGTCAGGG + Intergenic
1167255399 19:48424871-48424893 GTGAAAAAGTCCCAGGGTCCTGG - Intronic
1168005202 19:53481236-53481258 CTTGGAACATGCCAGGGTCCAGG - Intronic
1168181377 19:54664795-54664817 CTGGGACCCTCCAAGGATCCTGG - Exonic
1168575218 19:57503563-57503585 CTGAGAAACTCCCCAGGTCCAGG - Intronic
926372925 2:12198513-12198535 CTGAGAGCCTCCCAGGAGCTGGG - Intergenic
929934746 2:46286474-46286496 CTGGGACCCTTCCAGGGTCCAGG + Intergenic
930919273 2:56731901-56731923 CTCAGAAGCTTTCAGGGTCCTGG + Intergenic
931807774 2:65824322-65824344 CTGAGCACCTCCTACTGTCCAGG - Intergenic
932440130 2:71729546-71729568 CTGATAAACTCACAGGGTTCTGG + Intergenic
932471822 2:71964192-71964214 CTGAGCACCTACCATGGGCCAGG + Intergenic
932569584 2:72931580-72931602 CTGAGAACCACCCAGGGTCCAGG + Intronic
935946204 2:108288904-108288926 CTGAGAGCCTCCCAAAGTGCTGG + Exonic
937253857 2:120541144-120541166 CAGAGACCCTGCCAGGGCCCAGG - Intergenic
938291250 2:130151931-130151953 CTAAGACCCTCCCAGAGCCCAGG - Exonic
938465295 2:131521028-131521050 CTAAGACCCTCCCAGAGCCCAGG + Intergenic
938596026 2:132787998-132788020 CTGCAAACCTCCCAGGGCCCAGG + Intronic
940420957 2:153478704-153478726 CTGGGAAACTCCCACGGCCCAGG - Exonic
944667868 2:201971996-201972018 CTGGGACCTTCCCAGGATCCAGG + Intergenic
944834794 2:203568504-203568526 CTGAGCACCTACCATGTTCCAGG + Intergenic
946106654 2:217376277-217376299 CTGAGAACCTACCATGTGCCAGG + Intronic
946144568 2:217719398-217719420 CTGGGAGCCTCTCATGGTCCTGG - Intronic
946202137 2:218076618-218076640 GTGAGAACCTCCCATGCACCAGG + Intronic
947709754 2:232306060-232306082 CTATGAACCTCCCTGGGTCTTGG - Intronic
948793900 2:240392488-240392510 CTGAGCACTTCGCAGGGTCTGGG - Intergenic
948984378 2:241511248-241511270 CTGAGCACCTGCCAAGGGCCAGG - Intergenic
1170206346 20:13802739-13802761 CTGAGCATCTACCATGGTCCTGG - Intronic
1170738125 20:19028112-19028134 ATGTGACCCTCCCAGGCTCCTGG + Intergenic
1171288695 20:23966874-23966896 CTGGGGACCTTCCTGGGTCCTGG - Intergenic
1171468832 20:25353674-25353696 CTGTGATCCTTCCAAGGTCCAGG + Intronic
1171522557 20:25786824-25786846 CAGAGAAGCTCCCTGGCTCCAGG - Intronic
1171530306 20:25848784-25848806 CAGAGAAGCTCCCTGGCTCCAGG - Exonic
1171554270 20:26069059-26069081 CAGAGAAGCTCCCTGGCTCCAGG + Intergenic
1172357502 20:34290462-34290484 CTGACAATCTCCCACGGTCTTGG - Intronic
1173020079 20:39259778-39259800 CTTAGAACCTACCAGGGAGCTGG - Intergenic
1173145226 20:40519192-40519214 CTGTGAACTTCCCAAGGTCAGGG + Intergenic
1173227103 20:41168407-41168429 CTGAGTGCCTCCCCGGGACCTGG - Intronic
1173380159 20:42532764-42532786 CTAAGCACCTCCCAGGGTCGTGG - Intronic
1174114811 20:48219594-48219616 CTGAGAGGCTGCCAGGGGCCAGG + Intergenic
1174423042 20:50412817-50412839 CTGAGCACCTACCATGCTCCAGG + Intergenic
1174741062 20:53014750-53014772 CTGGGAACCTCTCAAGGTCAGGG + Intronic
1175105081 20:56609437-56609459 CTGAGCACCTCCCAGATGCCAGG - Intergenic
1175487073 20:59354188-59354210 CTGAGAACTTCCCAGGTCACAGG + Intergenic
1176070746 20:63224980-63225002 CTGAGGGCCTCCCAGAGCCCAGG - Intergenic
1176668699 21:9711940-9711962 CTAGGAACCTCCCTGTGTCCAGG + Intergenic
1179803707 21:43824301-43824323 ACGAGAACCTCCCAGGGGCAGGG - Intergenic
1179984843 21:44914423-44914445 CGGAGAACCCCTCAGGGGCCGGG + Intronic
1180229989 21:46421442-46421464 TTCAAAACCTCCCAGGGCCCTGG - Intronic
1180843334 22:18969358-18969380 GTGAGGACCTCCCAGAGCCCTGG - Intergenic
1181058139 22:20269377-20269399 GTGAGGACCTCCCAGAGCCCTGG + Intronic
1181550660 22:23637306-23637328 CTGTGAGGCTCCCAGGGTCTGGG - Intergenic
1181822349 22:25485942-25485964 CTGAGAACCTACCATGTGCCAGG - Intergenic
1183245801 22:36692503-36692525 CAGAGGACCTCCCAGGTTGCAGG + Intronic
1184244214 22:43227703-43227725 CAGAAAACCACCCAGGTTCCTGG - Intronic
1184408875 22:44315330-44315352 CTGAGACCCACACAGGGGCCTGG + Intergenic
1184468489 22:44682631-44682653 TTGAGAACCTCCTATGGGCCAGG - Intronic
1184565183 22:45287558-45287580 CTGAGAACATCCCAGGTTCCAGG + Intronic
1184614545 22:45629316-45629338 CTGAGAACCTCCTAGATTCTGGG + Intergenic
1184621590 22:45683021-45683043 CTCAGAACCTTCCATGGGCCGGG + Intronic
1185010605 22:48310841-48310863 CAGAGAAGCTGACAGGGTCCTGG - Intergenic
1185048998 22:48543962-48543984 CCGAGGAGCTCCCAGGGGCCTGG + Intronic
949954833 3:9259114-9259136 TTCAGATCCTCCCCGGGTCCTGG + Intronic
950276487 3:11665709-11665731 CTGATCACCTCCCAGGTGCCAGG + Intronic
950864228 3:16175842-16175864 CTGAGAACCCACCAGTGCCCAGG - Intronic
951188537 3:19742245-19742267 TTGAGAACCTACCATGTTCCAGG + Intergenic
951531391 3:23701714-23701736 CAGACAGCCTGCCAGGGTCCAGG - Intergenic
951631870 3:24730712-24730734 CTGAGGACCTACCATGTTCCAGG - Intergenic
952431965 3:33232387-33232409 CTGGAGACTTCCCAGGGTCCTGG - Intergenic
953371098 3:42389127-42389149 ATGAGCACCTCCGAGGGTCCTGG - Intergenic
953926954 3:46987470-46987492 CTAAGCCCCTCCCAGGGGCCAGG - Intronic
954956046 3:54518990-54519012 CTAAGAACCTCACAGGGTGTGGG + Intronic
955105738 3:55895987-55896009 CTGTGAAACTCACAGGTTCCTGG - Intronic
956772045 3:72535048-72535070 GTCAGACCCTCCCAGGGGCCTGG - Intergenic
956776203 3:72567619-72567641 TTGAGAAGCTCCCAGGGACTTGG - Intergenic
960703554 3:120460169-120460191 CTGAGATTCTCTCAGGGTCTGGG + Intergenic
961482794 3:127194986-127195008 CTGAGCACCTCCCATGGTCCAGG + Intronic
962259407 3:133893605-133893627 CTGAGAACCTACCAGGGGCCAGG + Intronic
962874525 3:139525612-139525634 CAGAGAACCTGCCAGGTGCCAGG + Intronic
966629493 3:182056840-182056862 CTGCGTACCTCACAGGGTCTTGG - Intergenic
966924599 3:184636093-184636115 CTGTGAACCCTCCAGGATCCAGG + Intronic
968227551 3:196984113-196984135 CTGAGAACATCACAGTATCCTGG - Intergenic
968284349 3:197499300-197499322 CTGAGAATCCCCCAGGGCCTGGG - Intergenic
968606490 4:1538036-1538058 ATGAGCACCTCCCAGGACCCAGG - Intergenic
968957995 4:3728741-3728763 CTGGGAACCTCTCAGGGCACGGG + Intergenic
969713104 4:8855661-8855683 CTGGGAGTCTCCAAGGGTCCTGG - Intronic
970487826 4:16542188-16542210 CTGAACACCTACCAGGTTCCAGG + Intronic
970789848 4:19844337-19844359 CTGGGAATCTCTCAGAGTCCTGG - Intergenic
973230871 4:47837639-47837661 CCGAGACCCTCCCAGGGTCATGG - Intronic
973637376 4:52872554-52872576 CTGAGCACCTGCCATGTTCCAGG - Intergenic
975088190 4:70368176-70368198 TTGAGAACCTACCAGGATACAGG + Intergenic
975783260 4:77861658-77861680 CTGAGAGCCTCCTATGGGCCTGG + Intergenic
984559147 4:181248009-181248031 CTGAGAACCTAACAGGGTGTTGG + Intergenic
985280608 4:188282791-188282813 CTGAGCACCTGCCAGGGCGCCGG + Intergenic
985406083 4:189639585-189639607 CTAGGAACCTCCCTGTGTCCAGG - Intergenic
985520168 5:370529-370551 CTGTGAGACTCTCAGGGTCCTGG - Intronic
985649926 5:1102700-1102722 CTGAGAACCTCCTCGAGTGCAGG - Intronic
989539060 5:42597721-42597743 CTCAGTACCTCCCAGCCTCCTGG - Intronic
990397598 5:55399355-55399377 CTGAGAAACTTTCAGGGTCTTGG - Intronic
992088517 5:73298537-73298559 CGGAGAAGGTCCCAAGGTCCGGG + Intergenic
992197406 5:74353729-74353751 CTGAGCACCTCTTAGGCTCCAGG + Intergenic
995256545 5:110053293-110053315 CTGAGAACCTGCTATGTTCCAGG - Intergenic
998160943 5:139812725-139812747 CTAAGAACCTCCCAGGTTGTGGG + Intronic
999140556 5:149358422-149358444 CTGAGCATCTGCCATGGTCCTGG + Intronic
1001545619 5:172568923-172568945 CTGATAAACTCCCATGGGCCAGG - Intergenic
1001755772 5:174167375-174167397 CTGAGCGCCTACCAGGGGCCAGG + Intronic
1002921150 6:1574393-1574415 CTGAGAAACTCACAGGGACAAGG + Intergenic
1005584238 6:27260331-27260353 CGGAGAACCACCCCGAGTCCAGG + Intergenic
1005719387 6:28586506-28586528 CTCAGAGCCTCCCTGGGCCCAGG + Exonic
1006285568 6:33091764-33091786 CTGACAGCATCCCCGGGTCCAGG - Intergenic
1007246583 6:40467700-40467722 CTCAGAACCTCCCATGGCCGAGG - Intronic
1007264303 6:40585667-40585689 CTGTGAAGTTCCCAGGGGCCAGG - Intronic
1008533258 6:52484680-52484702 TTGGGAACCTCCAAGAGTCCTGG + Intronic
1010221361 6:73451754-73451776 CTGGGCACGTCCCAGGGCCCGGG + Exonic
1014272698 6:119350350-119350372 CTCAAAAGCTCCCAGGGTCACGG - Intergenic
1015185314 6:130408945-130408967 CTGGGAATATCCCAGGGTCAGGG - Intronic
1015512997 6:134058139-134058161 CTGGGTGCCTCCCAGGGTCTTGG - Intergenic
1015540183 6:134305960-134305982 TTGATAACCCCCCAGGGGCCAGG + Intronic
1016530383 6:145052748-145052770 CTGATAACCTCACAGGGTTTTGG + Intergenic
1017455783 6:154600043-154600065 CTGAGCACCTACTAGGTTCCAGG - Intergenic
1017971598 6:159316287-159316309 CTGGAAACCTCCCAGAGTCCAGG - Intergenic
1018066358 6:160127374-160127396 ACGAGAACCACACAGGGTCCTGG - Intronic
1018932486 6:168250413-168250435 CTGAGGACCTCCCAGCACCCGGG + Intergenic
1019333831 7:473362-473384 CTGAGAATGTCCCTGGGTCCAGG + Intergenic
1019390657 7:784696-784718 CTGCAAACCTCCCACGGGCCAGG - Intronic
1021575912 7:22105679-22105701 CTGAGAGCATCCCAGGGAGCTGG - Intergenic
1022098788 7:27157011-27157033 CAGAGACCCTTCCAGGGTCTGGG - Intronic
1022599837 7:31747399-31747421 TTGAGAACCCACCAGGTTCCTGG - Intergenic
1023830401 7:44035884-44035906 CTGAGCACCTCCTAGGTTCCAGG - Intergenic
1024605643 7:51020451-51020473 CGGAGAACCTACTAGGGTCCGGG - Intronic
1025283042 7:57642027-57642049 CAGAGAAGCTCCCTGGCTCCAGG - Intergenic
1025800175 7:64779767-64779789 CTGATAATCTCTCAGGGTTCCGG + Intergenic
1026491780 7:70869821-70869843 GTGAGAGCCTCCAAGGGTCCTGG - Intergenic
1026524392 7:71141629-71141651 CTGAGTACCTACCATGGCCCAGG - Intronic
1028473564 7:91230189-91230211 ATGTGAACATCCCAGGGACCAGG - Intergenic
1029177437 7:98674941-98674963 CTGAGAGCCTCCAAGGGTCGTGG + Intergenic
1029620989 7:101689537-101689559 ATCAGAGCCTCCCATGGTCCCGG + Intergenic
1029740725 7:102490178-102490200 CTGAGCACCTCCTAGGTTCCAGG - Intronic
1029758719 7:102589351-102589373 CTGAGCACCTCCTAGGTTCCAGG - Intronic
1031931974 7:127694716-127694738 CTGAGTACCTACCATGGTCCTGG - Intronic
1031997397 7:128241551-128241573 CTGACAGTCTCCCAGGGACCTGG - Intronic
1032797992 7:135292907-135292929 GTCAGAACCTCTCAGGGTTCTGG - Intergenic
1034297340 7:149986037-149986059 CAGAAAACCTTCCAGGGTCTGGG - Intergenic
1034329976 7:150273954-150273976 CTGAGCACCTCGCATGGGCCAGG + Intronic
1034668081 7:152835906-152835928 CTGAGCACCTCGCATGGGCCAGG - Intronic
1034808684 7:154110817-154110839 CAGAAAACCTTCCAGGGTCTGGG + Intronic
1034976384 7:155451144-155451166 GTGAGCATCTCCCAGGGTCCGGG - Intergenic
1034977463 7:155456822-155456844 TTTAGAACCTCCGAGGCTCCTGG + Intergenic
1036641278 8:10585580-10585602 CTGGGAAACTCCCAGGGGCATGG - Intergenic
1036685972 8:10910582-10910604 CTCAGAAGAGCCCAGGGTCCAGG - Intronic
1039902619 8:41764204-41764226 TTGAGAACCTCCTAGGGGCCAGG + Intronic
1040061050 8:43103059-43103081 CTGAGTACCTCCCAGGGAACAGG + Intronic
1042224921 8:66507993-66508015 CTGAGAAACTCTCAGGTGCCTGG + Intronic
1045180989 8:99782477-99782499 CTGAGATCCTCCCAAGGTCAAGG - Intronic
1045313859 8:101026742-101026764 CTGACTACTTCCCAGGGGCCAGG + Intergenic
1047307115 8:123661896-123661918 CTCAGAACCTACCAGGATTCAGG + Intergenic
1049493551 8:142917526-142917548 CTGAGTGCCTGGCAGGGTCCTGG + Intronic
1049547522 8:143240430-143240452 CTGAGATCCTCCCGGCATCCTGG - Intergenic
1050345160 9:4679314-4679336 CTGAGTACCTCCCGGCGGCCAGG + Intergenic
1051820861 9:21166110-21166132 CTGACAACCTCCCAGGCACAAGG + Exonic
1051822720 9:21187029-21187051 CTGACAACCTCCCAGGCACAAGG + Exonic
1051824272 9:21201663-21201685 CTGACAACCTCCCAGGCACAAGG + Exonic
1051824609 9:21206595-21206617 CTGACAACCTCCCAGGCACAAGG + Exonic
1051825712 9:21216803-21216825 CTGACAACCTCCCAGGCACAAGG + Exonic
1051826543 9:21227671-21227693 CTGACAACCTCCCAGGCACAAGG + Exonic
1051827721 9:21239433-21239455 CTGACAACCTCCCAGGCACAAGG + Exonic
1051836972 9:21350385-21350407 CTGACAACCTCCCAGGCACAAGG + Exonic
1051838482 9:21367505-21367527 CTGACAACCTCCCAGGCACAAGG + Exonic
1051839955 9:21384830-21384852 CTGACAACCTCCCAGGCACAAGG + Exonic
1051844936 9:21440988-21441010 CTGACAACCTCCCAGGCACAAGG - Exonic
1051921829 9:22275465-22275487 CTGTGGACCCCCCAGGGACCTGG + Intergenic
1054451153 9:65404216-65404238 CTGGGACCCTCCCAGGGCACTGG + Intergenic
1056559815 9:87720282-87720304 CTGAGAAACTCCAAGGGCCCAGG + Intergenic
1057132089 9:92661339-92661361 CTGAGAACCTCCCAGGGTCCAGG - Intronic
1057859329 9:98627202-98627224 CAGAGAAAGTCCCAGAGTCCGGG - Intronic
1058976278 9:110127940-110127962 CTGAGGACCTCGCACGGCCCAGG + Intronic
1059239890 9:112795489-112795511 CTGAGTACCTACCATGGGCCAGG + Intronic
1059386776 9:113970909-113970931 CTGAGAGCCTGCTAGGGGCCAGG - Intronic
1059460105 9:114424236-114424258 CTGAGAACCTACAAGGGGTCAGG - Intronic
1059492094 9:114676514-114676536 CTGAAAACCTGCCATGTTCCAGG + Intergenic
1060003812 9:119981943-119981965 TTGAGCACCTCCCAAGTTCCAGG - Intergenic
1060856233 9:126916048-126916070 CTGTGTGCCTCCCAGGGGCCTGG + Intronic
1060999478 9:127894963-127894985 CGGAGAACCTTCCATGTTCCAGG - Intronic
1061076026 9:128341696-128341718 CACAGAACCTCCCTGGGTTCTGG + Intronic
1061408541 9:130405872-130405894 ATGAGAACCTTCAAGGGTCAGGG + Intronic
1061421926 9:130477354-130477376 CTGAGCACCTTCCGGGGTCAGGG - Intronic
1062211170 9:135365089-135365111 CTGAGCACCTGCCTGGGTTCAGG - Intergenic
1062596067 9:137300204-137300226 AGGAGAACCTCCCCGGGCCCAGG + Intergenic
1203657168 Un_KI270753v1:9001-9023 CTAGGAACCTCCCTGTGTCCAGG - Intergenic
1185695695 X:2192800-2192822 CTGGGTATCTCCCAGGGTCTGGG - Intergenic
1189733880 X:44049535-44049557 CTCAGAGCCTCCAAGGGCCCTGG - Intergenic
1190108061 X:47573150-47573172 TTGAGAACCTGTTAGGGTCCAGG - Intronic
1190448425 X:50554184-50554206 ATGAGCACCTCCTAGGTTCCAGG + Intergenic
1190936918 X:55006036-55006058 CTGAGGACCTGCAAGGATCCAGG - Intronic
1192197133 X:69036094-69036116 CTGAGCACCTCCCTGGATCTTGG + Intergenic
1192345206 X:70297613-70297635 CTGAGAACCTACCATGTGCCAGG + Intronic
1192549981 X:72045894-72045916 CTGAGAACTTCCCAGTGCCAAGG + Intergenic
1193902991 X:87205634-87205656 CTGAGACCCTCCCAGGGGATGGG + Intergenic
1194434101 X:93848970-93848992 CTGGGAAATTCCCAGGGCCCTGG + Intergenic
1195308966 X:103611548-103611570 CTGGGAACCTCCCTGGTCCCTGG + Intronic
1195929833 X:110063502-110063524 CTGCGAACCTCTCTGGTTCCAGG - Intronic
1199615451 X:149651956-149651978 CCCAGGACCTCCCAGGGTCGAGG + Intergenic
1199874996 X:151922014-151922036 CCCAGGACCTCCCAGGGCCCAGG - Intronic
1200827329 Y:7658495-7658517 TTGAGGTCCTCCCTGGGTCCGGG + Intergenic
1201410876 Y:13698308-13698330 CTGGGAACCTGTCAGGGGCCAGG - Intergenic