ID: 1057132090

View in Genome Browser
Species Human (GRCh38)
Location 9:92661345-92661367
Sequence AAGACGCTGAGAACCTCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 137}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057132090_1057132101 28 Left 1057132090 9:92661345-92661367 CCCTGGGAGGTTCTCAGCGTCTT 0: 1
1: 0
2: 0
3: 12
4: 137
Right 1057132101 9:92661396-92661418 GAGTCACCAGCAGGCTCTGGGGG No data
1057132090_1057132099 26 Left 1057132090 9:92661345-92661367 CCCTGGGAGGTTCTCAGCGTCTT 0: 1
1: 0
2: 0
3: 12
4: 137
Right 1057132099 9:92661394-92661416 CTGAGTCACCAGCAGGCTCTGGG No data
1057132090_1057132100 27 Left 1057132090 9:92661345-92661367 CCCTGGGAGGTTCTCAGCGTCTT 0: 1
1: 0
2: 0
3: 12
4: 137
Right 1057132100 9:92661395-92661417 TGAGTCACCAGCAGGCTCTGGGG No data
1057132090_1057132098 25 Left 1057132090 9:92661345-92661367 CCCTGGGAGGTTCTCAGCGTCTT 0: 1
1: 0
2: 0
3: 12
4: 137
Right 1057132098 9:92661393-92661415 ACTGAGTCACCAGCAGGCTCTGG No data
1057132090_1057132094 -10 Left 1057132090 9:92661345-92661367 CCCTGGGAGGTTCTCAGCGTCTT 0: 1
1: 0
2: 0
3: 12
4: 137
Right 1057132094 9:92661358-92661380 TCAGCGTCTTTCTGGTGGCCAGG No data
1057132090_1057132097 19 Left 1057132090 9:92661345-92661367 CCCTGGGAGGTTCTCAGCGTCTT 0: 1
1: 0
2: 0
3: 12
4: 137
Right 1057132097 9:92661387-92661409 GCTGCTACTGAGTCACCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057132090 Original CRISPR AAGACGCTGAGAACCTCCCA GGG (reversed) Intronic
900309069 1:2024737-2024759 AAGAGGCTGAGGACCTCCCGGGG + Intronic
900593447 1:3469831-3469853 AAGACGTGGAGCACTTCCCAGGG + Intronic
901613308 1:10516865-10516887 AAGAATCTGAGCACATCCCAAGG - Intronic
902383823 1:16065238-16065260 AGGACCCTGAGAAACTCCCAGGG - Intronic
902989165 1:20174147-20174169 AAGGCTCTGAGGTCCTCCCATGG + Intronic
903578009 1:24351162-24351184 AAGTGGCTGAGCACCTCCAAGGG - Intronic
903812997 1:26045435-26045457 AAGACCCTGGGAACCGGCCAAGG + Intronic
907726059 1:57021701-57021723 AACACGCTGAGGACCTGCCTGGG - Intronic
908504695 1:64784868-64784890 AAGATGCTGACAAGGTCCCAAGG - Intronic
915194964 1:154182663-154182685 AAGCCGCTGAGCCCCTCCCACGG + Intronic
917726621 1:177833829-177833851 AAGATGATGATTACCTCCCACGG - Intergenic
921018281 1:211212486-211212508 AAGATACTGAGAAGCTACCAAGG + Intergenic
923526787 1:234778909-234778931 AACACGCTGAGAGCATCCCCTGG + Intergenic
1064280801 10:13949847-13949869 AAGACGCTGAGAAATCTCCATGG - Intronic
1065757093 10:28940857-28940879 AAGAAGCTGAGAACATCTCCAGG - Intergenic
1069890969 10:71652261-71652283 AAGATGCTGCCAGCCTCCCAAGG - Intronic
1075219245 10:120570129-120570151 CAGAGGTTGAGTACCTCCCATGG - Intronic
1075223019 10:120600886-120600908 AAGAGGCTGAGATCCTGCCTCGG + Intergenic
1076405064 10:130206147-130206169 ATGACGAAGAGCACCTCCCAAGG - Intergenic
1079125797 11:17718131-17718153 AAGAGGCTGAGAGACCCCCATGG + Intergenic
1083793824 11:65003020-65003042 AAGAGTCTGAGAGCATCCCAGGG + Intergenic
1088786647 11:113188301-113188323 GAGACCCTGAGAACCTCAAAGGG + Intronic
1095967765 12:47880301-47880323 AAGTAGCTCAGAGCCTCCCAAGG - Intronic
1096815727 12:54200660-54200682 AAGAAGCTGAAGACCTCACAGGG + Intergenic
1098669644 12:73209507-73209529 AAGACAATGAGAATCTGCCACGG - Intergenic
1099579667 12:84428176-84428198 AAGAGGCAAAGAACCTCCCTTGG - Intergenic
1101558555 12:105833842-105833864 GAGAGGCTGAGAACATGCCAGGG - Intergenic
1103220313 12:119238945-119238967 GAGACACTGGGAACCTGCCACGG + Intergenic
1107132664 13:36912690-36912712 GAGATGCTGAGAACATCCCTAGG - Intronic
1108495910 13:51025220-51025242 AAGTCCCTGAGAAATTCCCAGGG - Intergenic
1110470068 13:75849540-75849562 AAGACGCTGACAAAATCACATGG + Intronic
1112327311 13:98450606-98450628 CAGAGGCTGAGTACCTCCCCAGG + Intronic
1117736843 14:58776312-58776334 AAGATGCTGATAACATTCCAGGG - Intergenic
1119892208 14:78191492-78191514 AGGAGGCTGAGACCTTCCCAGGG + Intergenic
1120195623 14:81479219-81479241 AAGAATCTGAGAACCTCCCCAGG - Intronic
1121340940 14:93104718-93104740 AGGATCCTGAGAACCTACCATGG - Intronic
1124631651 15:31341105-31341127 AAAACACTGAGAGCCTCCCAAGG - Intronic
1127685143 15:61336229-61336251 ATGAAGCAGACAACCTCCCAGGG - Intergenic
1130292396 15:82614118-82614140 AGGACGCTGGGAGCCTCCCGAGG - Intronic
1130486977 15:84403594-84403616 CCCACGCTAAGAACCTCCCATGG + Intergenic
1131678645 15:94698642-94698664 AGGATGCTGAGCAGCTCCCAAGG + Intergenic
1132846457 16:2003126-2003148 AAGACACCGAGAGCCGCCCACGG + Intronic
1135135255 16:19882588-19882610 GAGACGCTGGGAGCCTCCAAGGG - Intronic
1136230679 16:28883595-28883617 AGGAGGCTAAGAATCTCCCAGGG - Intronic
1137921132 16:52489565-52489587 AAGAAGCTGAGAACCTTTCCAGG - Intronic
1139421825 16:66853754-66853776 AAGACCCTGGGAACCTCCTCTGG + Exonic
1143872541 17:9967365-9967387 ATGACGCTGAGTATCTCGCAAGG - Intronic
1144748892 17:17634592-17634614 CAGAGGCTGAGATCCTCCCGAGG + Intergenic
1146605858 17:34257064-34257086 AAGACCCTCAAAACATCCCAGGG - Exonic
1152318546 17:79595056-79595078 AAGACGCTGATCCCCTCCCTGGG + Intergenic
1152572904 17:81128312-81128334 CAGATGCTGAGGACCTCCCTGGG + Intronic
1153630273 18:7062475-7062497 AAAACGCTTAGACCATCCCAGGG + Intronic
1159370776 18:67525069-67525091 AAGACGCTGAAAAACCCCAAGGG + Intergenic
1161496353 19:4588177-4588199 AAGAATCTCAGGACCTCCCATGG - Intergenic
1166818931 19:45564441-45564463 AGGACTCTGAGAACAGCCCAGGG + Intronic
932447174 2:71788043-71788065 AAGACACTGAGAGCATCTCAGGG + Intergenic
932488583 2:72103928-72103950 AAGACTCTGAGAGCAACCCAAGG - Intergenic
934680296 2:96278759-96278781 AAGACTGTGAGAACCACCAAAGG + Intronic
934725375 2:96613732-96613754 AAGCCTCTGAAAACCTCCTAAGG + Intronic
936014977 2:108951107-108951129 AGGATGCTGAGAAACTCCCAGGG - Intronic
936501277 2:113068361-113068383 AAGACACTGAGGAGCTACCAAGG - Intronic
937322766 2:120970780-120970802 AAGAAGCTGGGAGCTTCCCATGG - Intronic
938556772 2:132431584-132431606 AAGACTCTGAGAAGCTGCCTTGG - Intronic
942466712 2:176215686-176215708 AATAGGTTCAGAACCTCCCAAGG - Intergenic
944552108 2:200853902-200853924 AAGACGCTGTAAACCTCTGAAGG - Exonic
944880575 2:204008661-204008683 AATACACTGAGAACCTACCCTGG - Intergenic
947017728 2:225639977-225639999 AAGAAGCTAAGAACCTGACAAGG + Intronic
948910818 2:241001786-241001808 AAGAAACTGAGATCCTCCCATGG - Intronic
1169468472 20:5862405-5862427 GAGAATCTGAGAACCTACCAAGG + Intronic
1172140668 20:32720832-32720854 GAGATGCTGTGACCCTCCCAGGG - Intronic
1173030439 20:39353639-39353661 AAGATGCTGAAAACCACCAATGG + Intergenic
1179154958 21:38841706-38841728 AAGGAACTGAGAACCTCCCAGGG + Intergenic
1179555864 21:42175486-42175508 AAGAAGCTGAGAAGCTTCGAAGG - Intergenic
1181716520 22:24734506-24734528 AAGACTCTGGAAACTTCCCAGGG + Intronic
1184322535 22:43753427-43753449 GACACGCTGAGAACCACCCTGGG + Intronic
1184428246 22:44425630-44425652 ACGACTCTGAAAACATCCCAGGG + Intergenic
1184994445 22:48195153-48195175 AAGAGGCTGAGCAGCTGCCATGG - Intergenic
1185000937 22:48245109-48245131 AAGAGCCTGAGGACCTCCCAGGG - Intergenic
950159849 3:10752188-10752210 AGACCGCTGAGACCCTCCCACGG + Intergenic
959228962 3:103621964-103621986 AACACACTCAGATCCTCCCAGGG + Intergenic
959755343 3:109891102-109891124 AAGATGCTGAGAACATACTATGG - Intergenic
962007679 3:131363714-131363736 TAGGCTCTGAGAACCTGCCAGGG - Intergenic
962010093 3:131383550-131383572 CAGGCTCTGAGAACCTGCCAGGG - Intronic
962189713 3:133297618-133297640 AAGTGACTGAGAATCTCCCAGGG - Intronic
963917897 3:150876820-150876842 AAGATAATGTGAACCTCCCAAGG + Intronic
965888996 3:173486443-173486465 AAAACGCTCAGAACCTTACATGG + Intronic
968744394 4:2352263-2352285 GAGAAGCTGAGAGCCTCCCCTGG + Intronic
969598152 4:8160371-8160393 AGGCTCCTGAGAACCTCCCAGGG + Intergenic
976275340 4:83271255-83271277 AATACGTTGAGAGCCTCCTATGG - Intronic
976571992 4:86623147-86623169 CAGAGGCTGAAAACCTCCCGGGG + Intronic
977153788 4:93547679-93547701 AAGAGTCTGAGAAATTCCCAAGG - Intronic
977978138 4:103291263-103291285 AAGGCACTGAGAACTTCCCTGGG + Intergenic
979784501 4:124698584-124698606 AAGACTCTGAGAACTTTCCAAGG + Intronic
985532712 5:443325-443347 AAGACGGCGACCACCTCCCAAGG - Intronic
985668896 5:1196343-1196365 GTGGCGCTGAGACCCTCCCAAGG + Intergenic
987339493 5:16927272-16927294 AAGACACAAAGAAGCTCCCATGG - Intronic
987378107 5:17256597-17256619 AAGCCACTGTTAACCTCCCAGGG - Intronic
993832250 5:92775061-92775083 AAGACAGTGAGAACCCTCCAGGG + Intergenic
995260016 5:110092730-110092752 AAGAGACTGAGAACCACACAGGG - Intergenic
996536111 5:124580037-124580059 AAGTCTCTGAGCTCCTCCCATGG - Intergenic
997416588 5:133733044-133733066 AAGTATCTGAGAAACTCCCATGG - Intergenic
998555048 5:143114984-143115006 AACAGGCTGAGAGCCTCACATGG - Intronic
1002128913 5:177067420-177067442 GGGAAGCTGAGAACCTCCCTTGG - Intronic
1003035602 6:2638249-2638271 AAGAAGCTGAGAACTTGGCAAGG + Intergenic
1003301845 6:4891273-4891295 AAGGCGCTGAGAACCTTCTGTGG - Intronic
1003796923 6:9615133-9615155 AGGACCTTGAGAACCTTCCATGG - Intronic
1004454976 6:15783953-15783975 AAAAAACTGAGAACATCCCAGGG - Intergenic
1004543277 6:16572056-16572078 ATGATGCTGAGAACTCCCCATGG - Intronic
1005341285 6:24845910-24845932 AGGACACTGAGAAGCTCCAAGGG + Intronic
1006390410 6:33754999-33755021 CAGAATCTCAGAACCTCCCAGGG - Intergenic
1007384367 6:41510660-41510682 AAGACACTGAGAGCCGCCCTTGG + Intergenic
1010599565 6:77807085-77807107 AAGAAGCTGATATCCTCTCAGGG - Intronic
1012410277 6:98948100-98948122 AGGACCCAGAGCACCTCCCATGG - Intergenic
1023035287 7:36126333-36126355 AAGACTCTGGGCACCTCACAGGG - Intergenic
1024613136 7:51084179-51084201 AAGACGCTGACAAACTGCCACGG + Intronic
1026152375 7:67799083-67799105 AAGATGCTGAGAGGCTCCCCAGG - Intergenic
1033677650 7:143558793-143558815 AAGGTGCTGAGTACCTGCCATGG - Intergenic
1033694186 7:143770647-143770669 AAGGTGCTGAGTACCTGCCATGG + Intergenic
1035467985 7:159092087-159092109 ACGGAGGTGAGAACCTCCCAGGG + Intronic
1036567277 8:9948265-9948287 AAAAAGCTGAGTACCCCCCAGGG - Intergenic
1039441792 8:37600140-37600162 AAAATGCTGAGAAACTCCCTGGG + Intergenic
1040286725 8:46104175-46104197 AAAATGCTGGGAGCCTCCCAAGG - Intergenic
1040289181 8:46115658-46115680 AAAATGCTGGGAGCCTCCCAAGG - Intergenic
1040291812 8:46129425-46129447 AAAATGCTGGGAGCCTCCCAAGG - Intergenic
1040295657 8:46147780-46147802 AAAATGCTGGGAGCCTCCCAAGG - Intergenic
1040301096 8:46188388-46188410 GGAACGCTGGGAACCTCCCAAGG - Intergenic
1040302136 8:46193546-46193568 AAAATGCTGGGAGCCTCCCAAGG + Intergenic
1040305608 8:46210244-46210266 AAAATGCTGGGAGCCTCCCAAGG + Intergenic
1040306406 8:46214155-46214177 AAAATGCTGGGACCCTCCCAAGG + Intergenic
1040306523 8:46214807-46214829 AAAATGCTGGGAGCCTCCCAAGG + Intergenic
1040307680 8:46220662-46220684 AGGATGCTGGGAGCCTCCCAAGG + Intergenic
1040308654 8:46225309-46225331 GGGATGCTGGGAACCTCCCAAGG + Intergenic
1040310079 8:46232314-46232336 CGGATGCTGGGAACCTCCCAAGG + Intergenic
1040314906 8:46255848-46255870 AAAATGCTGAAAACCTCACAAGG + Intergenic
1040333597 8:46404847-46404869 AAAATGCTGGGAGCCTCCCAAGG + Intergenic
1040341812 8:46444876-46444898 AAAATGCTGGGAGCCTCCCAAGG - Intergenic
1040341861 8:46445092-46445114 AAAATGCTGGGAGCCTCCCAAGG - Intergenic
1041087866 8:54273242-54273264 AATACACTGAAAACATCCCAGGG + Intergenic
1042021809 8:64377405-64377427 AAGAGGCTGAGAGCCTTCCGTGG - Intergenic
1042118989 8:65463675-65463697 AAGACGTGGAGAACCCCACATGG + Intergenic
1048292164 8:133189614-133189636 GAGATGCTGAGAACTTGCCAAGG + Intergenic
1049092023 8:140523227-140523249 AAGAAGCTGAGCAGCTCCAAGGG - Intergenic
1050264441 9:3875135-3875157 AAGACGCTGAGTTCCTCTCATGG + Intronic
1057132090 9:92661345-92661367 AAGACGCTGAGAACCTCCCAGGG - Intronic
1062059992 9:134490103-134490125 AAGGCCCTGTGACCCTCCCAGGG - Intergenic
1185593100 X:1291579-1291601 AAGAGGCTGGGAACGTCCAACGG - Intronic
1192233535 X:69281893-69281915 AAGATGCTGAGAACTTTCCCGGG - Intergenic
1193473409 X:81934245-81934267 AAGACCCTGAGCAGCTCCTAGGG - Intergenic
1198377221 X:136052106-136052128 TAGACACTGAGAACCTCACCTGG + Intergenic
1198655015 X:138904431-138904453 ATGAGGCTGAGCACCTACCAGGG + Intronic