ID: 1057132091

View in Genome Browser
Species Human (GRCh38)
Location 9:92661346-92661368
Sequence AAAGACGCTGAGAACCTCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 143}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057132091_1057132098 24 Left 1057132091 9:92661346-92661368 CCTGGGAGGTTCTCAGCGTCTTT 0: 1
1: 0
2: 0
3: 11
4: 143
Right 1057132098 9:92661393-92661415 ACTGAGTCACCAGCAGGCTCTGG No data
1057132091_1057132099 25 Left 1057132091 9:92661346-92661368 CCTGGGAGGTTCTCAGCGTCTTT 0: 1
1: 0
2: 0
3: 11
4: 143
Right 1057132099 9:92661394-92661416 CTGAGTCACCAGCAGGCTCTGGG No data
1057132091_1057132100 26 Left 1057132091 9:92661346-92661368 CCTGGGAGGTTCTCAGCGTCTTT 0: 1
1: 0
2: 0
3: 11
4: 143
Right 1057132100 9:92661395-92661417 TGAGTCACCAGCAGGCTCTGGGG No data
1057132091_1057132101 27 Left 1057132091 9:92661346-92661368 CCTGGGAGGTTCTCAGCGTCTTT 0: 1
1: 0
2: 0
3: 11
4: 143
Right 1057132101 9:92661396-92661418 GAGTCACCAGCAGGCTCTGGGGG No data
1057132091_1057132097 18 Left 1057132091 9:92661346-92661368 CCTGGGAGGTTCTCAGCGTCTTT 0: 1
1: 0
2: 0
3: 11
4: 143
Right 1057132097 9:92661387-92661409 GCTGCTACTGAGTCACCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057132091 Original CRISPR AAAGACGCTGAGAACCTCCC AGG (reversed) Intronic
900309068 1:2024736-2024758 GAAGAGGCTGAGGACCTCCCGGG + Intronic
900405826 1:2492614-2492636 AAAGACTCTGAGACCCTTCTGGG - Intronic
901808319 1:11751446-11751468 AAAGAGGCTCAGTACCTGCCTGG + Intronic
902237242 1:15065321-15065343 AAAGACCCTGAGAACAGGCCAGG - Intronic
902383824 1:16065239-16065261 CAGGACCCTGAGAAACTCCCAGG - Intronic
906701909 1:47865636-47865658 AAAGAGGATGAGAACCTCTCTGG - Intronic
907726060 1:57021702-57021724 AAACACGCTGAGGACCTGCCTGG - Intronic
913241751 1:116835818-116835840 AAAGGAGCTGGGTACCTCCCAGG + Intergenic
920346472 1:205308897-205308919 GAAGATGCTGAGAACTTCCAAGG - Intronic
921313673 1:213870562-213870584 AAAGAGGCTGAGAACCAAGCAGG + Intergenic
922799514 1:228358769-228358791 AAAGAGGCTGAAAATCTGCCTGG - Intronic
924005486 1:239605904-239605926 AAAGACCCAGAGAACCCCCTTGG - Intronic
1067061609 10:43080705-43080727 ACAGACGCTGAGATACTCTCTGG + Intronic
1067423092 10:46175422-46175444 AAAGTCGCTGTGAGCCTGCCAGG + Intergenic
1071644844 10:87353422-87353444 AAAGTCGCTGTGAGCCTGCCAGG - Intergenic
1075010231 10:118862144-118862166 AAAGATGCTGGGAACATCACTGG + Intergenic
1077796463 11:5497796-5497818 AAAGCTGCTGAGAAACTCCATGG - Intronic
1078159450 11:8828208-8828230 ACAGACGCTGAGAACCTAGAAGG + Intronic
1084534457 11:69748472-69748494 TAACACACTGAGGACCTCCCAGG - Intergenic
1085073015 11:73565161-73565183 AAAGACCCTGACAACCTTACAGG + Intronic
1091803908 12:3342572-3342594 TAAGATGCTGAGAAGCACCCAGG - Intergenic
1093156153 12:15688506-15688528 AAACACCCTGAGAACCTAGCAGG + Intronic
1096479078 12:51926100-51926122 AAAGAGCCTGAGAACCTTACTGG + Intergenic
1096588741 12:52643405-52643427 AAGGTCCCTGAGAACCACCCAGG - Intergenic
1100845091 12:98650041-98650063 GAATACCCTGAGAACCTACCAGG - Intronic
1101326493 12:103720272-103720294 AAAGACCTTCAGAATCTCCCAGG - Intronic
1101558556 12:105833843-105833865 AGAGAGGCTGAGAACATGCCAGG - Intergenic
1102991801 12:117321432-117321454 AAAGGCGGTGAGAAGCCCCCTGG + Intronic
1106872714 13:34038957-34038979 AAAGATGCTGAGAACCTGAGTGG - Intergenic
1113064959 13:106363580-106363602 AAAGATGCTGAAAACTTCACGGG - Intergenic
1113575774 13:111394355-111394377 AAAACCGCTGTGAACATCCCTGG - Intergenic
1117736844 14:58776313-58776335 AAAGATGCTGATAACATTCCAGG - Intergenic
1120345982 14:83291022-83291044 AAATAGGCAGACAACCTCCCTGG - Intergenic
1123005806 14:105323196-105323218 AAAGTGGCTGAGAGCTTCCCGGG - Intronic
1123983022 15:25621164-25621186 CAAGCTGCTGAGAACCTGCCTGG + Intergenic
1124512134 15:30336469-30336491 AGCCACCCTGAGAACCTCCCAGG - Intergenic
1124730780 15:32194282-32194304 AGCCACCCTGAGAACCTCCCAGG + Intergenic
1125036374 15:35129164-35129186 AAAGACGCTTAGATTCTCTCAGG - Intergenic
1125525202 15:40369975-40369997 AGAGACGCTGAGCCCCTCCAGGG - Exonic
1128727065 15:69996070-69996092 AAAGACCCTGAGAGCCACGCTGG + Intergenic
1133799416 16:9073065-9073087 AGAGCCTCTTAGAACCTCCCTGG + Intergenic
1134288783 16:12886485-12886507 AAAGGAGCTGAGATCATCCCAGG + Intergenic
1135135256 16:19882589-19882611 AGAGACGCTGGGAGCCTCCAAGG - Intronic
1135253824 16:20924269-20924291 AAAGATGCTGAGAAACTCTAGGG - Exonic
1135389457 16:22077767-22077789 AAGGCTTCTGAGAACCTCCCTGG + Intronic
1137756213 16:50904537-50904559 AATGAAGGTGACAACCTCCCAGG + Intergenic
1139109798 16:63875973-63875995 AAAAAAGATGAGAACCTCCCTGG + Intergenic
1140617336 16:76681835-76681857 AAAGCCTCTTAGAACCTCCTTGG - Intergenic
1141652747 16:85402285-85402307 CAAGACGCTGAGAAGCTCGGGGG + Intergenic
1144320134 17:14108403-14108425 AAAGTCGCTGAGAACATCAATGG - Intronic
1144439102 17:15265394-15265416 ATAGAGGCTGAGAACCTCTCAGG - Intergenic
1146605859 17:34257065-34257087 AAAGACCCTCAAAACATCCCAGG - Exonic
1146637981 17:34520107-34520129 AGAGAGGTTGAGACCCTCCCAGG + Intergenic
1148508154 17:48144828-48144850 AAAAATGCTGAGAGGCTCCCAGG + Intronic
1148538040 17:48457061-48457083 AAAGATGCTGGAAACCTCCTTGG - Intergenic
1152318545 17:79595055-79595077 GAAGACGCTGATCCCCTCCCTGG + Intergenic
1152572903 17:81128311-81128333 CCAGATGCTGAGGACCTCCCTGG + Intronic
1153186784 18:2494995-2495017 AGAGAAGCAGAGAACCACCCAGG - Intergenic
1155272592 18:24155221-24155243 AAGGAAGCTGAAAACCTCCATGG - Intronic
1155990314 18:32272892-32272914 TAAGAGGCTGAGAACCAACCAGG + Intronic
1161263811 19:3353428-3353450 AAAGTTGCTGGGAACCTTCCTGG - Intergenic
1166305273 19:41934019-41934041 CAAGAGGCTGAGAACCTGCCAGG + Intergenic
1167358224 19:49016799-49016821 AAAGACCCAGAGACCCTTCCCGG + Intronic
1167359723 19:49023688-49023710 AAAGACCCAGAGACCCTTCCCGG + Intronic
1167362244 19:49036388-49036410 AAAGACCCAGAGACCCTTCCCGG + Intronic
1167363838 19:49044470-49044492 AAAGACCCAGAGACCCTTCCCGG - Intronic
1167364660 19:49048457-49048479 AAAGACCCAGAGACCCTTCCCGG + Intronic
1167365949 19:49055093-49055115 AAAGACCCAGAGACCCTTCCCGG + Intronic
925885815 2:8392924-8392946 GGAGATGCTGAGAAGCTCCCAGG + Intergenic
925995652 2:9290688-9290710 AAAGATACTGAGATCCTGCCAGG - Intronic
926372927 2:12198520-12198542 AAGGAGTCTGAGAGCCTCCCAGG - Intergenic
931094916 2:58928492-58928514 ACAAACGCTGCGAAGCTCCCAGG - Intergenic
936014978 2:108951108-108951130 CAGGATGCTGAGAAACTCCCAGG - Intronic
937851786 2:126642649-126642671 AATGAAGCTGCAAACCTCCCAGG + Intergenic
939991154 2:148877072-148877094 AAAGATGCTGGGGACCGCCCGGG - Intronic
941854199 2:170213421-170213443 AAAGACACTGTGAAACTTCCCGG - Intronic
942448096 2:176091872-176091894 AAAGACCCTGAGAACGGCGCCGG - Intergenic
946030036 2:216696229-216696251 AAAGAGAGAGAGAACCTCCCTGG - Intergenic
1173596964 20:44264645-44264667 AAAGTCTCAGAGGACCTCCCAGG + Intronic
1175105452 20:56611551-56611573 AATGAGGCTGAGACCCTGCCTGG - Intergenic
1176098761 20:63355734-63355756 AAAGAGGCTGAGGGCATCCCTGG - Intronic
1176108614 20:63401064-63401086 TCAGACGCTGAGGACCTCTCAGG + Intergenic
1176904293 21:14481012-14481034 AAAGAGGCTGAGAAGCTACCAGG - Intergenic
1177712611 21:24798287-24798309 AAAGCTGCTGTGAAACTCCCTGG - Intergenic
1179154957 21:38841705-38841727 CAAGGAACTGAGAACCTCCCAGG + Intergenic
1181716519 22:24734505-24734527 AAAGACTCTGGAAACTTCCCAGG + Intronic
1181865294 22:25850039-25850061 AAGGAGGCTGGTAACCTCCCAGG + Intronic
1181956228 22:26589741-26589763 ACAGACGCTGAGCGTCTCCCAGG + Intronic
1183706349 22:39477047-39477069 GAAGACAGTGAGCACCTCCCCGG - Intronic
1184322534 22:43753426-43753448 GGACACGCTGAGAACCACCCTGG + Intronic
1185000938 22:48245110-48245132 GAAGAGCCTGAGGACCTCCCAGG - Intergenic
951945676 3:28133196-28133218 AAAAACCCTGAGAGCCTCCAAGG + Intergenic
954734662 3:52696419-52696441 AAGGACTCTTAGAACCACCCAGG + Intronic
957244783 3:77702944-77702966 ATAGACTCTGAGTTCCTCCCAGG + Intergenic
957484100 3:80834934-80834956 AAAGACTCTGGGAACCATCCTGG + Intergenic
959228961 3:103621963-103621985 AAACACACTCAGATCCTCCCAGG + Intergenic
959944516 3:112112653-112112675 CAAGATGCTGAGAAGATCCCAGG - Intronic
962368994 3:134805242-134805264 AAAGGAGCTGAGAGCATCCCCGG - Intronic
967600514 3:191382101-191382123 AAAGAATCTGAGAAACTCCTGGG - Intronic
969154261 4:5196273-5196295 AAAGAAGAAGAGAACCTCGCGGG - Intronic
969598151 4:8160370-8160392 AAGGCTCCTGAGAACCTCCCAGG + Intergenic
970052198 4:11927035-11927057 AAATACGCTGGGAATATCCCTGG - Intergenic
971253560 4:24993306-24993328 AAAGAGGTTGAGAGCTTCCCCGG - Intergenic
973637781 4:52876022-52876044 AAAGACGTAGAGACCCTCTCGGG - Intronic
976179746 4:82387627-82387649 AAAGAAGCTGAGAACAGGCCAGG + Intergenic
976571991 4:86623146-86623168 TCAGAGGCTGAAAACCTCCCGGG + Intronic
977978137 4:103291262-103291284 GAAGGCACTGAGAACTTCCCTGG + Intergenic
978293165 4:107170370-107170392 AAAGATGGTCAAAACCTCCCTGG - Intronic
978512242 4:109533416-109533438 AAAGACGATGTGAACCACTCTGG + Intronic
986728229 5:10615924-10615946 AAAGAGGCTGAAAACCTCAGTGG + Intronic
993524208 5:88944514-88944536 AAAGAAGCAGAGAACTTCCAGGG + Intergenic
993851681 5:93018053-93018075 ACAGACACTGAGCACCTCCACGG + Intergenic
1004454977 6:15783954-15783976 AAAAAAACTGAGAACATCCCAGG - Intergenic
1004694952 6:18024868-18024890 AAAGGCAATGAGACCCTCCCCGG - Intergenic
1006745024 6:36335579-36335601 ACAAACACTGAGAGCCTCCCAGG - Intronic
1011166044 6:84447689-84447711 AAAGGCACAGAGAAACTCCCAGG + Intergenic
1016876514 6:148870761-148870783 AAAGAGGGTGAGAGCATCCCAGG - Intronic
1018762589 6:166904702-166904724 AAGGATGCTGAGAAAATCCCAGG + Intronic
1022571048 7:31454678-31454700 GAAGAAACTGAGAGCCTCCCTGG + Intergenic
1022753476 7:33258159-33258181 AAAGGCACTGAAAACCTCCAAGG - Intronic
1022772779 7:33492404-33492426 AAAGACGTCGAGGACCTCCTGGG + Intronic
1023125708 7:36952122-36952144 AGAGATGCTGAACACCTCCCTGG - Intronic
1023204121 7:37729650-37729672 AAAGGAGCTGAGAATGTCCCGGG + Intronic
1030101763 7:105953002-105953024 AAAAACGCTGAGACCCTAGCAGG + Intronic
1031642498 7:124181451-124181473 AAAGAAGCTGATCACCTCCAGGG - Intergenic
1032514069 7:132494099-132494121 AAAGATGCTGAGAACCGCAGAGG - Intronic
1033345987 7:140526121-140526143 AAAGACGCTGCAGGCCTCCCTGG + Intronic
1034091552 7:148368828-148368850 AAAGACACTGTGAAACTTCCTGG - Intronic
1034931259 7:155165797-155165819 AAAAACCCTGAGACCCTCGCGGG + Intergenic
1035467984 7:159092086-159092108 AACGGAGGTGAGAACCTCCCAGG + Intronic
1035471612 7:159113268-159113290 AAAGACACTGTGAAACTTCCCGG + Intronic
1035786121 8:2262575-2262597 AAAGACACAGAGTACCTCGCTGG - Intergenic
1035806686 8:2459141-2459163 AAAGACACAGAGTACCTCGCTGG + Intergenic
1037196921 8:16201764-16201786 AAAGAAGCTGAGAAACAACCTGG - Intronic
1037901633 8:22692387-22692409 AAAGACGCCGGGCTCCTCCCGGG + Intronic
1038406047 8:27323742-27323764 AAAGACATTGAGAAACTCTCTGG - Intronic
1038668128 8:29559098-29559120 AAATAAGCTGAGCACCTCCTGGG + Intergenic
1039300281 8:36201712-36201734 AAACAGCCTGAGAACCTACCAGG - Intergenic
1039441791 8:37600139-37600161 AAAAATGCTGAGAAACTCCCTGG + Intergenic
1041340967 8:56845041-56845063 AAACAGGCTGAGAACATCCAAGG + Intergenic
1043237366 8:77884911-77884933 AAAGAGGCTGGGACCTTCCCTGG + Intergenic
1045829293 8:106438973-106438995 AAAGGTGCTTAGAACCTTCCTGG + Intronic
1046318522 8:112538900-112538922 AAAGAAGATGAAAACCTCACTGG + Intronic
1047771202 8:128031379-128031401 AAACAGGCTGATAAGCTCCCTGG - Intergenic
1050475631 9:6037960-6037982 ACAGACCCTCAGAAACTCCCTGG + Intergenic
1052107009 9:24531237-24531259 AAAGAAGCTGAGAACTTCCTAGG - Intergenic
1057132091 9:92661346-92661368 AAAGACGCTGAGAACCTCCCAGG - Intronic
1057839979 9:98478473-98478495 AAAGCCTCTGAGAAACTCCTCGG + Intronic
1060733743 9:126053367-126053389 AAAGATGCTGAGGACACCCCAGG - Intergenic
1061306060 9:129734059-129734081 AAGGCTTCTGAGAACCTCCCTGG - Intergenic
1189751074 X:44223465-44223487 AAAGACACTGTGAACCACCCAGG + Intronic
1189959105 X:46307818-46307840 AAAAACTCTGAGACCCTCGCAGG - Intergenic
1190497487 X:51040574-51040596 TAAGATGCTGAGAAGCTTCCAGG - Intergenic
1192233536 X:69281894-69281916 AAAGATGCTGAGAACTTTCCCGG - Intergenic
1196742149 X:119034407-119034429 ACAGAAGCTGAGAAAGTCCCAGG + Intergenic