ID: 1057132097

View in Genome Browser
Species Human (GRCh38)
Location 9:92661387-92661409
Sequence GCTGCTACTGAGTCACCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057132089_1057132097 25 Left 1057132089 9:92661339-92661361 CCTGGACCCTGGGAGGTTCTCAG 0: 1
1: 1
2: 4
3: 46
4: 341
Right 1057132097 9:92661387-92661409 GCTGCTACTGAGTCACCAGCAGG No data
1057132090_1057132097 19 Left 1057132090 9:92661345-92661367 CCCTGGGAGGTTCTCAGCGTCTT 0: 1
1: 0
2: 0
3: 12
4: 137
Right 1057132097 9:92661387-92661409 GCTGCTACTGAGTCACCAGCAGG No data
1057132091_1057132097 18 Left 1057132091 9:92661346-92661368 CCTGGGAGGTTCTCAGCGTCTTT 0: 1
1: 0
2: 0
3: 11
4: 143
Right 1057132097 9:92661387-92661409 GCTGCTACTGAGTCACCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057132097 Original CRISPR GCTGCTACTGAGTCACCAGC AGG Intronic
No off target data available for this crispr