ID: 1057133423

View in Genome Browser
Species Human (GRCh38)
Location 9:92670144-92670166
Sequence GCCGGGGGCGTGGCTTCCGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 275
Summary {0: 1, 1: 0, 2: 5, 3: 26, 4: 243}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057133423_1057133426 -9 Left 1057133423 9:92670144-92670166 CCGCCGGAAGCCACGCCCCCGGC 0: 1
1: 0
2: 5
3: 26
4: 243
Right 1057133426 9:92670158-92670180 GCCCCCGGCGCCTGCCATGACGG 0: 1
1: 0
2: 0
3: 6
4: 135
1057133423_1057133432 -2 Left 1057133423 9:92670144-92670166 CCGCCGGAAGCCACGCCCCCGGC 0: 1
1: 0
2: 5
3: 26
4: 243
Right 1057133432 9:92670165-92670187 GCGCCTGCCATGACGGAGTCGGG 0: 1
1: 0
2: 0
3: 3
4: 56
1057133423_1057133431 -3 Left 1057133423 9:92670144-92670166 CCGCCGGAAGCCACGCCCCCGGC 0: 1
1: 0
2: 5
3: 26
4: 243
Right 1057133431 9:92670164-92670186 GGCGCCTGCCATGACGGAGTCGG 0: 1
1: 0
2: 1
3: 4
4: 56
1057133423_1057133435 7 Left 1057133423 9:92670144-92670166 CCGCCGGAAGCCACGCCCCCGGC 0: 1
1: 0
2: 5
3: 26
4: 243
Right 1057133435 9:92670174-92670196 ATGACGGAGTCGGGCAATTCCGG 0: 1
1: 0
2: 0
3: 2
4: 36
1057133423_1057133436 8 Left 1057133423 9:92670144-92670166 CCGCCGGAAGCCACGCCCCCGGC 0: 1
1: 0
2: 5
3: 26
4: 243
Right 1057133436 9:92670175-92670197 TGACGGAGTCGGGCAATTCCGGG 0: 1
1: 0
2: 0
3: 0
4: 38

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057133423 Original CRISPR GCCGGGGGCGTGGCTTCCGG CGG (reversed) Exonic