ID: 1057133925

View in Genome Browser
Species Human (GRCh38)
Location 9:92673245-92673267
Sequence CAGTGGGAATGCAGAGGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057133917_1057133925 16 Left 1057133917 9:92673206-92673228 CCGTCTCAAAAAGAAAAAAGAAA 0: 108
1: 3286
2: 91314
3: 73336
4: 93545
Right 1057133925 9:92673245-92673267 CAGTGGGAATGCAGAGGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057133925 Original CRISPR CAGTGGGAATGCAGAGGAGA GGG Intergenic
No off target data available for this crispr