ID: 1057135198

View in Genome Browser
Species Human (GRCh38)
Location 9:92682501-92682523
Sequence CAATGGGCGTGGGGGCCAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057135185_1057135198 14 Left 1057135185 9:92682464-92682486 CCTGCATCTTACCCTGAGTGAGG No data
Right 1057135198 9:92682501-92682523 CAATGGGCGTGGGGGCCAGATGG No data
1057135190_1057135198 2 Left 1057135190 9:92682476-92682498 CCTGAGTGAGGAAGATTGGGAGC No data
Right 1057135198 9:92682501-92682523 CAATGGGCGTGGGGGCCAGATGG No data
1057135189_1057135198 3 Left 1057135189 9:92682475-92682497 CCCTGAGTGAGGAAGATTGGGAG No data
Right 1057135198 9:92682501-92682523 CAATGGGCGTGGGGGCCAGATGG No data
1057135183_1057135198 29 Left 1057135183 9:92682449-92682471 CCCACATAGGGAGATCCTGCATC No data
Right 1057135198 9:92682501-92682523 CAATGGGCGTGGGGGCCAGATGG No data
1057135184_1057135198 28 Left 1057135184 9:92682450-92682472 CCACATAGGGAGATCCTGCATCT No data
Right 1057135198 9:92682501-92682523 CAATGGGCGTGGGGGCCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057135198 Original CRISPR CAATGGGCGTGGGGGCCAGA TGG Intergenic
No off target data available for this crispr