ID: 1057137785

View in Genome Browser
Species Human (GRCh38)
Location 9:92706043-92706065
Sequence CTGTAACTTCAGATGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057137778_1057137785 24 Left 1057137778 9:92705996-92706018 CCAGCAGACCTGGCTCACTTCTT No data
Right 1057137785 9:92706043-92706065 CTGTAACTTCAGATGGTGGAAGG No data
1057137782_1057137785 16 Left 1057137782 9:92706004-92706026 CCTGGCTCACTTCTTGGGGCATA No data
Right 1057137785 9:92706043-92706065 CTGTAACTTCAGATGGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057137785 Original CRISPR CTGTAACTTCAGATGGTGGA AGG Intergenic
No off target data available for this crispr