ID: 1057138525

View in Genome Browser
Species Human (GRCh38)
Location 9:92712506-92712528
Sequence TTTCTAAGTGTACCACAATT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 193}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057138523_1057138525 2 Left 1057138523 9:92712481-92712503 CCCTAAAAATCGACGACTGTAGA 0: 1
1: 0
2: 0
3: 4
4: 39
Right 1057138525 9:92712506-92712528 TTTCTAAGTGTACCACAATTTGG 0: 1
1: 0
2: 1
3: 13
4: 193
1057138524_1057138525 1 Left 1057138524 9:92712482-92712504 CCTAAAAATCGACGACTGTAGAA 0: 1
1: 0
2: 0
3: 4
4: 51
Right 1057138525 9:92712506-92712528 TTTCTAAGTGTACCACAATTTGG 0: 1
1: 0
2: 1
3: 13
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057138525 Original CRISPR TTTCTAAGTGTACCACAATT TGG Exonic
900912333 1:5608896-5608918 TTTCCATGTGTCCCAGAATTTGG + Intergenic
901534010 1:9871115-9871137 TTTCTAAGGGAACCACAAGTCGG + Intronic
903073233 1:20739573-20739595 ATTCTGAGTGTCCCACAACTAGG + Intergenic
906538738 1:46568602-46568624 TTTTTTAATGTACCATAATTGGG - Intronic
906902556 1:49851642-49851664 TTTTTCACTGTACCACAATGTGG - Intronic
909090011 1:71213764-71213786 TTGCTAATTTTACCTCAATTAGG - Intergenic
910502112 1:87904216-87904238 TTTCTAATTGTCCAACAGTTTGG - Intergenic
911793066 1:102042923-102042945 TTTCTAAGAGTACAGCAATGAGG - Intergenic
912607547 1:111007770-111007792 ATTCTAAGTGTAGCAGAAATTGG + Intergenic
914869808 1:151463564-151463586 TTTTTAGGAGTACCACTATTAGG - Intergenic
915492045 1:156255955-156255977 TTTCATAGTGTCCCTCAATTTGG - Intronic
918810493 1:189112336-189112358 TTTACAAGTGTACAACAATGAGG + Intergenic
920838343 1:209532896-209532918 TTTCCTAGGGTACCACAAATTGG + Intergenic
922181397 1:223236027-223236049 TTTGTAAGTGTTCCAGATTTTGG + Intronic
922414728 1:225410668-225410690 TTTGTAAGTGTCCCTCAGTTTGG - Intronic
1063779718 10:9307722-9307744 TTTGTAAGTGTCCCATGATTTGG - Intergenic
1064084247 10:12333328-12333350 TTTCTGAGTGTACAAAACTTGGG + Intergenic
1065067070 10:21980462-21980484 TTTTAAAGTGTCCCACAGTTTGG - Intronic
1066748960 10:38633222-38633244 GTTCTAAGTGTATGACAATCTGG + Intergenic
1066931022 10:41758965-41758987 TTTCTAAGGGTTCTACAGTTTGG + Intergenic
1066967704 10:42284563-42284585 GTTCTAAGTGTATGACAATCTGG - Intergenic
1068505072 10:57890304-57890326 TTTCTAAAAGCATCACAATTTGG + Intergenic
1068905269 10:62315149-62315171 TTTTTCAGTGTACCAAGATTAGG - Intergenic
1069122977 10:64591584-64591606 TTTCTTTCTGCACCACAATTAGG - Intergenic
1070804407 10:79262457-79262479 TTACTCAGTGTAACACACTTGGG - Intronic
1071151611 10:82641934-82641956 TTTCTTAGTGTACATTAATTTGG - Intronic
1072472799 10:95729745-95729767 TTTTTAAATGTACCACTACTAGG - Intronic
1073502022 10:103948458-103948480 TTTCAAAGCCTTCCACAATTTGG - Intergenic
1074739101 10:116467111-116467133 CTTCTAAGGGTACTCCAATTTGG - Intronic
1075434369 10:122422462-122422484 CTTCTCAGTGGACCACTATTAGG - Intronic
1079766192 11:24396107-24396129 CTCTTAATTGTACCACAATTGGG + Intergenic
1081523611 11:43907488-43907510 TTTCTGTGTGTACCATGATTTGG + Intronic
1081855747 11:46302416-46302438 TTTCTAAGTGGGGCACAATGTGG - Intronic
1082189882 11:49230184-49230206 TGTCTGAGTCTACCACAAGTGGG - Intergenic
1083049403 11:59763589-59763611 TTTCTAATTGTATCACTGTTAGG - Intronic
1085003197 11:73060239-73060261 TGTCTAATTGTACCATATTTTGG + Intronic
1086075504 11:82846856-82846878 TTAGTTGGTGTACCACAATTTGG - Intronic
1086232875 11:84591732-84591754 ATTCTAAGTGTAGCAAAGTTGGG - Intronic
1086676640 11:89616335-89616357 TGTCTGAGTCTACCACAAGTGGG + Intergenic
1087452234 11:98339684-98339706 TTTTTAAGTTTACAAAAATTGGG + Intergenic
1091631955 12:2168762-2168784 TTGCAAAGTGTACCCAAATTGGG + Intronic
1092664460 12:10780149-10780171 TTGCTAACTGTATCAGAATTAGG - Intergenic
1093381299 12:18497233-18497255 TTTCTAAGTGAAACATTATTTGG - Intronic
1093795551 12:23306072-23306094 TTTTTAAGTCTTCCAAAATTAGG - Intergenic
1097909913 12:64958680-64958702 TCTCTGAGTATCCCACAATTTGG + Intergenic
1098808299 12:75050199-75050221 TTTCTAATTGAACCCCAAGTAGG - Intronic
1099654862 12:85477357-85477379 TTTCTAATTGTACCACTAGATGG + Intergenic
1100664822 12:96739486-96739508 TTTCTAAGTGTAATAGCATTAGG + Intronic
1101454756 12:104819186-104819208 TTTCTACCTGTACTGCAATTAGG - Intronic
1107274006 13:38656434-38656456 TGTCTAAATGTACTATAATTAGG - Intergenic
1108928125 13:55778433-55778455 TTTGTAAGTGTAGTAGAATTTGG - Intergenic
1111483518 13:88864553-88864575 TTTTTAATTGTACCACTAATAGG - Intergenic
1111773892 13:92634587-92634609 TTTCAAAGTGTACAAAATTTCGG - Intronic
1111995592 13:95163278-95163300 TTTAAAAATGAACCACAATTTGG + Intronic
1113988893 13:114342851-114342873 TATATGAATGTACCACAATTTGG + Intergenic
1114813726 14:25930434-25930456 TTTCTAAGATGACCACATTTGGG + Intergenic
1117235101 14:53765424-53765446 TTTCTAAGTGTTTCACATCTGGG - Intergenic
1120298521 14:82676446-82676468 TTTCTTATTGAACCTCAATTGGG + Intergenic
1120614120 14:86681123-86681145 TTTCTAAGTGTCCTACCAGTGGG + Intergenic
1121770262 14:96529278-96529300 TTTCAAAGTCTCCCCCAATTTGG - Intronic
1126712541 15:51475551-51475573 TTTTTAAGTGTCCCTCAATTTGG - Intronic
1126804630 15:52334848-52334870 GCTCTCTGTGTACCACAATTTGG - Intronic
1130364376 15:83221028-83221050 TTTTTATGTATACCAGAATTTGG - Intergenic
1135994712 16:27239182-27239204 TTTCTAAGTTGACCAGAACTGGG + Intronic
1139083211 16:63551516-63551538 TTTCTATGTGTACCACAAAACGG + Intergenic
1139150168 16:64372709-64372731 ATTCTAATAGTACCAGAATTAGG - Intergenic
1144401188 17:14903936-14903958 ATTCCAAGTGTCCCATAATTTGG + Intergenic
1144859030 17:18288477-18288499 TTTGTAAGTGTACCTCTATGTGG + Intronic
1145185332 17:20788997-20789019 TCTCTAAGTGTAGCTCAAATAGG + Intergenic
1145893708 17:28438222-28438244 TATCTAACTATAACACAATTAGG + Intergenic
1154131898 18:11744423-11744445 TTTTTAAGTGTACTATAATTAGG + Intronic
1154522540 18:15245460-15245482 TTTCTGAGTGTCCCTCACTTAGG + Intergenic
1156942623 18:42788431-42788453 ATTCTAAGTGTAACAAAATGTGG - Intronic
1158020210 18:52832810-52832832 TTTATAAGTGTACCCCAAACTGG - Intronic
1158494749 18:57944500-57944522 AATCTAAGTGTACTACAATTAGG - Intergenic
1158505178 18:58041243-58041265 TTTCTATGTATAGCAAAATTTGG + Intergenic
1158830809 18:61276082-61276104 TTTCTAAGTGTATTACATTAGGG - Intergenic
1159535315 18:69707525-69707547 TTTATCACTGTACCACTATTAGG + Intronic
1159692125 18:71501964-71501986 TTTATAAGTGTTCCATAATATGG + Intergenic
1159703842 18:71662456-71662478 ATTCTAAGTGTAAGACAATTAGG - Intergenic
1160147414 18:76376381-76376403 TTTCTAAGTGTACTGTAAATTGG - Intronic
1160503773 18:79416221-79416243 TTTCACAGTTTATCACAATTTGG + Intronic
1166842009 19:45703168-45703190 CTTCCAATTGTAGCACAATTAGG - Exonic
925635810 2:5940778-5940800 GTTCCAAGTGTACCAAGATTGGG - Intergenic
926200373 2:10791483-10791505 TTTCTAGGTGTGACATAATTGGG - Intronic
928876599 2:36047311-36047333 TTGTAAAGTGTCCCACAATTTGG - Intergenic
929162722 2:38849070-38849092 TATCTATGTGTACCACAAAGAGG + Intronic
930339209 2:50091220-50091242 TTTCTCAGAAAACCACAATTTGG + Intronic
930568218 2:53049898-53049920 TATATAAATGTATCACAATTTGG - Intergenic
934311952 2:91875344-91875366 GTTCTAAGTGTATGACAATCTGG + Intergenic
935807699 2:106765275-106765297 CAGCTAAGTGCACCACAATTGGG - Intergenic
938803307 2:134783304-134783326 TTTCTAAGTTTTCTACAATGTGG - Intergenic
938865982 2:135420946-135420968 TTTCTATCTGTATCAGAATTTGG + Intronic
940549925 2:155140820-155140842 TTTTTGAGTGTTCCACAGTTAGG + Intergenic
940770220 2:157831584-157831606 TTTTTTAGTTTACCAAAATTGGG + Intronic
940953973 2:159708369-159708391 ATTCCAAGTGTTCCACAAATTGG + Intergenic
942488769 2:176468487-176468509 TTTCTCAGTGTCTCACAGTTTGG + Intergenic
944297169 2:198078949-198078971 TTTCTAAGTGTATAAGCATTAGG + Intronic
945925658 2:215800768-215800790 TTTCTAATTTTACTACATTTTGG - Intergenic
947232602 2:227903063-227903085 ATTCTGAATGTCCCACAATTTGG - Exonic
1169026734 20:2377823-2377845 TTTCTAAGAGTTCAAAAATTAGG + Intergenic
1170998711 20:21391939-21391961 TTTCTAAGCATAGCAAAATTCGG - Intergenic
1171174889 20:23044197-23044219 TTTCTAAGTTAAGTACAATTTGG + Intergenic
1173838926 20:46144377-46144399 TTCCTAAGTGTTCCAGAAATAGG - Intergenic
1179250657 21:39668633-39668655 GTTCTAAATGTACCACAGCTGGG - Exonic
1180538709 22:16421172-16421194 GTTCTAAGTGTATGACAATCTGG + Intergenic
950220844 3:11194998-11195020 TTTCTATGCATACCACACTTTGG + Intronic
951133570 3:19076806-19076828 TTTCTAGGTTTACCACCAATAGG - Intergenic
956865810 3:73367453-73367475 TTTTTAAGAGTCCCAGAATTTGG + Intergenic
960484598 3:118236414-118236436 TTTCTAAGTGTAGTATAATAGGG + Intergenic
961244275 3:125437714-125437736 TTTCTAAGTCACCCACACTTGGG - Intergenic
962404586 3:135089973-135089995 TTTGTCAGTGAAACACAATTAGG - Intronic
964962368 3:162442831-162442853 TTTCAAAGTGCAGCAAAATTTGG + Intergenic
966048944 3:175589826-175589848 TTTTTAAATGTACCACCATTCGG - Intronic
966111658 3:176409499-176409521 TGTCCAAGTACACCACAATTTGG - Intergenic
966227313 3:177611725-177611747 TTTCTAAGTGCCCCGTAATTTGG + Intergenic
966507414 3:180722064-180722086 TCTCCAAGTGTACCCCTATTTGG - Intronic
968268990 3:197386092-197386114 TTACTATGTGTAGCACATTTTGG + Intergenic
968269045 3:197386874-197386896 TTTCTATCTGTAGCACATTTGGG + Intergenic
969040524 4:4291971-4291993 CTACTAAGAGTACCAAAATTAGG + Intronic
969165034 4:5300507-5300529 TTTCTAAGTGTAGAATAATGTGG - Intronic
969828788 4:9779300-9779322 TATCTAAGTGTACAGCAGTTGGG - Intronic
971946102 4:33279391-33279413 TTTTTATGTGTACTGCAATTAGG - Intergenic
972292543 4:37703406-37703428 TTCCTAAGTGTTCCACATTCTGG + Intergenic
976580704 4:86732488-86732510 TTTCTAAGAGTGACACAAATTGG - Intronic
977091144 4:92677229-92677251 TTTCTAAGTGTGCAACATTGTGG - Intronic
977481302 4:97579688-97579710 TTTTAAAGTGTACCACACTAAGG + Intronic
978107789 4:104925324-104925346 TTTCTGAGTGTAGCAAAATATGG - Intergenic
978573444 4:110165071-110165093 CTTATATGTTTACCACAATTTGG - Intronic
979072949 4:116234019-116234041 TTTTTAAGTCAATCACAATTAGG - Intergenic
980255859 4:130380674-130380696 ATTTTAGGTGTACAACAATTTGG + Intergenic
981570937 4:146149709-146149731 TTTGTAATTGTCCCACAGTTTGG + Intergenic
982505243 4:156209044-156209066 TTTCTGGGTGTGCCAAAATTAGG - Intergenic
983033192 4:162828896-162828918 TTTATAATTATTCCACAATTAGG - Intergenic
983497665 4:168461348-168461370 TTTCTTATTATACTACAATTAGG + Intronic
983884439 4:172964565-172964587 TTTGTGAATGTTCCACAATTCGG - Intronic
987912986 5:24173272-24173294 TTTCTAATGGTACCAAAATATGG + Intronic
988249678 5:28740185-28740207 TTTCTAAGTGGATAATAATTAGG - Intergenic
989801476 5:45546432-45546454 TTTCTAAATGGTCCAGAATTTGG - Intronic
989852480 5:46231816-46231838 TTTCTAAGGATTCAACAATTTGG + Intergenic
991985473 5:72281554-72281576 TTTATGAGTGTAGCAGAATTTGG + Intronic
995232294 5:109781079-109781101 TTTCAAAGTGTACAATGATTTGG - Intronic
996838946 5:127825046-127825068 TTTCTAAGAGTATCAAAATCTGG - Intergenic
999033675 5:148322287-148322309 TTTCTATGTGTACCACACACAGG - Intronic
999040604 5:148406309-148406331 TTTCTAAGTGTTCCAAGTTTCGG - Exonic
999800043 5:155025051-155025073 TGTTTATGTGAACCACAATTCGG + Intergenic
1002840436 6:900541-900563 CTTCTCAGTGTACCACATCTGGG - Intergenic
1004347314 6:14860779-14860801 ATTCTAATTGTCCAACAATTAGG - Intergenic
1004738393 6:18431516-18431538 TTACTGAGTATACCACAATGGGG + Intronic
1005344216 6:24873515-24873537 TTTATTCTTGTACCACAATTAGG - Intronic
1005798727 6:29396321-29396343 TTTTTAAGTGCACCACCACTTGG - Intronic
1007315622 6:40986265-40986287 TTTCAAAGTGTACCCCAACCAGG - Intergenic
1007567529 6:42863861-42863883 TTACTAAAAGTACCAAAATTAGG + Intronic
1008118006 6:47575532-47575554 TTTGTAGGTGCACCACAATATGG + Intronic
1008468548 6:51857430-51857452 TTTTTAAGTGTTGCACACTTGGG + Intronic
1009549035 6:65062507-65062529 TTTTTAAGTGTAATATAATTAGG + Intronic
1010028965 6:71252902-71252924 TTTCTAAGTTTACCAAAGGTTGG + Intergenic
1010158028 6:72817727-72817749 TTACTAAAAGTACCAAAATTAGG + Intronic
1012350439 6:98243737-98243759 CTTTTAAGTGTACCACAATCTGG + Intergenic
1012542124 6:100373246-100373268 TTTCTCATTATACCACAACTGGG - Intergenic
1012841118 6:104330311-104330333 CTTCTAAGTATTCCTCAATTGGG + Intergenic
1013772146 6:113640062-113640084 TTCCTAACTATTCCACAATTTGG - Intergenic
1016379282 6:143457706-143457728 TTTTTAAGTGTGCCAGAACTTGG - Intronic
1016918274 6:149265426-149265448 TTTCTCAGCTTCCCACAATTGGG + Intronic
1017827389 6:158092045-158092067 TTTCTAAGTGTACCATTCATTGG - Intronic
1018014517 6:159699888-159699910 GTTCTCAGTGGACCACAATCTGG - Intronic
1023328844 7:39091227-39091249 TTTCTAAGTGCACTTCAATGGGG + Intronic
1023523490 7:41073030-41073052 TGTCTAAGTGTCCCTCAGTTAGG - Intergenic
1024774889 7:52772441-52772463 CTTCTAAATGTACAACTATTAGG - Intergenic
1028162458 7:87500847-87500869 ATTCTAGGCTTACCACAATTTGG + Intergenic
1028289760 7:89050081-89050103 ATTATGAGTTTACCACAATTTGG + Intronic
1031589871 7:123577606-123577628 TTTCTAAGAGGACCACATTTTGG - Intronic
1031800783 7:126242270-126242292 TTTGTAACTGTACCACAATTAGG + Intergenic
1031904361 7:127444761-127444783 TTACTAATTGTGCCACAATATGG - Intergenic
1032835894 7:135673249-135673271 ATTCTAAGTGTAGCACATTTGGG + Intronic
1032878604 7:136064953-136064975 TTTCTAAATGTATCAGGATTAGG + Intergenic
1032946461 7:136858907-136858929 TTTCTAATTGTATTACAATATGG - Intergenic
1035532650 8:365591-365613 TTTCTAAGGGGACCACAGATGGG + Intergenic
1037332462 8:17756838-17756860 CTTCTCAGTGTACCCTAATTTGG - Intronic
1037425123 8:18747157-18747179 TTTAAAAATGTACCACAAATTGG + Intronic
1039088245 8:33801010-33801032 TTTCTCAGTGGCCTACAATTTGG - Intergenic
1039333564 8:36565539-36565561 TTTCTAATTTTATCACAATGAGG - Intergenic
1039859883 8:41448004-41448026 TTTCTCAGTGTCCCAGAATCTGG + Intergenic
1041541256 8:58987723-58987745 TTACTAAGTATCCCACAGTTAGG - Intronic
1043245403 8:77993592-77993614 TGTCTAAATGTACCCCAACTAGG + Intergenic
1044683918 8:94808948-94808970 TTTCTAATTTTAACAAAATTAGG + Intergenic
1044706664 8:95015495-95015517 TTTAAAAGTGTACCGCAGTTAGG - Intronic
1046576139 8:116031784-116031806 TTTGTAAAAGTACCACAAATTGG - Intergenic
1047236847 8:123049118-123049140 TTTCTCATTATATCACAATTAGG - Intronic
1047803843 8:128338159-128338181 CTTCTAAGTGGACCACAGCTTGG + Intergenic
1047913620 8:129558093-129558115 TTACTAAGAGTAACACAATAGGG + Intergenic
1048387527 8:133926439-133926461 TATTTAAATGTATCACAATTGGG + Intergenic
1051024023 9:12584320-12584342 TTCCAAACTGTACAACAATTTGG + Intergenic
1051393708 9:16595038-16595060 TTTAAAAGTGTACCACTTTTTGG - Intronic
1057138525 9:92712506-92712528 TTTCTAAGTGTACCACAATTTGG + Exonic
1058748838 9:108018745-108018767 TTTCTAACTCTACCACCATTTGG + Intergenic
1059467901 9:114480974-114480996 TTTCTAAATGTTCCACAATGAGG + Intronic
1059832464 9:118112967-118112989 TGTGTAGGAGTACCACAATTTGG - Intergenic
1186940623 X:14503408-14503430 TTCCAGAGGGTACCACAATTGGG + Intergenic
1189408274 X:40745369-40745391 TTGCTAAGTGTGCCACACTAAGG - Intergenic
1189907453 X:45776307-45776329 TTTCTATGTGTTCCTCAATTTGG + Intergenic
1192219534 X:69188043-69188065 TTTCTAACTGCACCCCAGTTAGG - Intergenic
1192817567 X:74610576-74610598 TTTTTAAATATACCTCAATTGGG - Intronic
1193863564 X:86701129-86701151 TTTCTACGTGTTGCTCAATTTGG - Intronic
1197188338 X:123614254-123614276 TTACTAAATGAAACACAATTGGG + Intronic
1197480859 X:126984217-126984239 ATTCTAAGTGCACCACAACCAGG - Intergenic
1198948773 X:142045129-142045151 TTTCTCAGTGAATCAAAATTAGG + Intergenic
1199423311 X:147672518-147672540 TGTATGAATGTACCACAATTTGG - Intergenic