ID: 1057139721

View in Genome Browser
Species Human (GRCh38)
Location 9:92719066-92719088
Sequence GCTCATCCTGGGCCACACTC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 2, 1: 0, 2: 2, 3: 23, 4: 211}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057139717_1057139721 -5 Left 1057139717 9:92719048-92719070 CCTCACTGAAGGTCACCAGCTCA 0: 1
1: 1
2: 2
3: 14
4: 142
Right 1057139721 9:92719066-92719088 GCTCATCCTGGGCCACACTCAGG 0: 2
1: 0
2: 2
3: 23
4: 211
1057139716_1057139721 1 Left 1057139716 9:92719042-92719064 CCAGCTCCTCACTGAAGGTCACC 0: 1
1: 1
2: 1
3: 22
4: 192
Right 1057139721 9:92719066-92719088 GCTCATCCTGGGCCACACTCAGG 0: 2
1: 0
2: 2
3: 23
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057139721 Original CRISPR GCTCATCCTGGGCCACACTC AGG Exonic
900573518 1:3371645-3371667 GCTCTTCCAGGGCCTCACCCAGG - Intronic
900754628 1:4425033-4425055 CCTCAGCCTGCGCCACCCTCAGG - Intergenic
901336837 1:8456710-8456732 GCTCTTCCTGGAACACACTCAGG + Intronic
903021504 1:20398574-20398596 GCTGAGCCTGGGCCTCACCCAGG + Intergenic
906552092 1:46673396-46673418 GGTCTTCCTGGGCCAGATTCAGG - Exonic
913058388 1:115182934-115182956 GCTCATCTTGGACCCTACTCGGG + Intergenic
914254892 1:145953854-145953876 GATCAGCCTGGGCAACACTGTGG + Intronic
918975777 1:191484018-191484040 CCTCATCCTGGGACTCACCCAGG - Intergenic
919490293 1:198197998-198198020 CCTCATCCTGTGCCACAGCCAGG - Intronic
920461048 1:206140792-206140814 GTTCAACCTGGTCCAAACTCTGG - Intergenic
920714772 1:208329484-208329506 GCTCATCATTGTCCTCACTCTGG - Intergenic
1063922821 10:10948940-10948962 GCTCCTCCTTCTCCACACTCAGG - Intergenic
1065668979 10:28093048-28093070 GCTAATACTGGGCTACAGTCTGG - Intronic
1067343286 10:45420968-45420990 GCCCAGCCTGGGCCACAGTTTGG + Intronic
1067469831 10:46528284-46528306 CCTGGTCCTGGGCCACTCTCAGG - Intergenic
1069572779 10:69504521-69504543 GCTCTTCCTGGTCCACCCTGGGG + Intronic
1071509487 10:86252225-86252247 GCTCTTCTTGGGCCACATCCCGG - Intronic
1072786898 10:98289888-98289910 GCTCATTCTGGTGCACACTGGGG - Intergenic
1073008557 10:100342611-100342633 GCTCCTCCTGGGCCCCAGGCTGG - Intergenic
1074051786 10:109887244-109887266 GCTGACCCTGGGCCACTCACTGG + Intronic
1075429721 10:122370200-122370222 GATCATCCAGGGCCACACTTGGG - Intergenic
1076165883 10:128282189-128282211 GCTGCTCCTGGGCCACACGCCGG + Intergenic
1076980654 11:202846-202868 GCTCACCCTGGTCCACAGGCTGG - Intronic
1078215868 11:9311490-9311512 CCTCATCCTGTGCCACAGCCAGG - Intronic
1078489815 11:11758427-11758449 GCTCATCCTGGGAGGCTCTCAGG - Intergenic
1081810636 11:45912154-45912176 GCTCCTTCTGGACCACACCCTGG - Intronic
1082613026 11:55325785-55325807 TTTCCTCCTGGGCCTCACTCAGG + Intergenic
1084793783 11:71491037-71491059 GGCCACCCTGGCCCACACTCAGG + Intronic
1085297992 11:75441665-75441687 GCTGAACCTGCGCTACACTCAGG - Exonic
1085330128 11:75641534-75641556 GCAGATCCTGGGCCCCACTCAGG - Intronic
1088312960 11:108479420-108479442 TCTCATGCTGGGCGACAGTCTGG - Exonic
1088578811 11:111297809-111297831 GCTCTTCCTGGGCCCGACACTGG - Intergenic
1088827559 11:113508381-113508403 GCTCAGCCTGGGTCACCCCCAGG - Intergenic
1089110274 11:116050239-116050261 GCTCCTCATGGGCCGCTCTCTGG + Intergenic
1089374192 11:117983001-117983023 CATCAGCCTGGGCCACCCTCAGG - Intergenic
1092145528 12:6212078-6212100 CCTCATCCTCTGCCACACCCTGG + Intronic
1093418998 12:18952847-18952869 CCTCTTCCTGGGCCCCAATCAGG - Intergenic
1096529914 12:52236055-52236077 GCTCAGGCTGGGCCCCACCCTGG + Intronic
1096709303 12:53443549-53443571 CCTCATCCTGTGCCACAGCCAGG + Exonic
1101809913 12:108098620-108098642 ACTCATGCTGGGTCACAGTCAGG + Intergenic
1108243923 13:48496639-48496661 GCTTCTCCTGGGCCACTCCCAGG + Intronic
1110009083 13:70308724-70308746 CCTTGTCCTGGGTCACACTCAGG - Intergenic
1111888676 13:94054497-94054519 GCTGATACTGGGCCACACTTTGG + Intronic
1113657732 13:112079303-112079325 GACCCTGCTGGGCCACACTCTGG + Intergenic
1114322293 14:21557252-21557274 GATCATCTTAGGACACACTCTGG - Intergenic
1114654873 14:24310099-24310121 GCTCATCCTGGGCCTCTCCTGGG - Intronic
1115307243 14:31945405-31945427 GCTGCTCCAGGGCCACACTTAGG + Intronic
1117591140 14:57269191-57269213 GCTCATCCTGCGCCGCATACCGG - Exonic
1119783712 14:77296935-77296957 GCTCTTCCAGGGCCACAGGCAGG - Intronic
1120954494 14:90069385-90069407 GCCAATCATGGGCCACACCCCGG - Intronic
1121115398 14:91339441-91339463 GCTGATCGTGGACCTCACTCAGG - Exonic
1123050449 14:105538861-105538883 GCTTGCCCTGGGTCACACTCGGG + Intergenic
1124617041 15:31249295-31249317 GCTTCCCCTGGGCCACTCTCAGG + Intergenic
1124631282 15:31338991-31339013 GCTCATCCTGGGAGACACTGTGG + Intronic
1127469391 15:59276808-59276830 GCTCTTCCTGGTCCCCACCCTGG - Intronic
1128795260 15:70462000-70462022 GGTCATACTGGGGAACACTCAGG + Intergenic
1128807354 15:70540783-70540805 GCTCATCCTGCCCCACCCTCAGG + Intergenic
1129451033 15:75651511-75651533 ACTCATCCTGGGTCACACAGGGG + Intronic
1129852274 15:78800269-78800291 GCACATCCGGGCCCACACCCCGG - Exonic
1130035727 15:80359776-80359798 GCCCTTCCTCGGCCACCCTCTGG + Intronic
1130142129 15:81236406-81236428 GCTCATCCTCCCACACACTCAGG - Intronic
1130300098 15:82674114-82674136 CCTCATCCTGGGCCAGGATCTGG + Intronic
1132155771 15:99494628-99494650 GCTCCACCTGCGCCACACTGGGG - Intergenic
1132987531 16:2775661-2775683 GGTGGTCCTGGGCCACACTGAGG - Intronic
1133126614 16:3651497-3651519 TCCCATGCTGGGCCCCACTCTGG - Intronic
1134818113 16:17222893-17222915 GCTCTTCGTGAACCACACTCAGG + Intronic
1137289601 16:47042938-47042960 TCCCATCCAGGGCCACACCCAGG - Intergenic
1137961147 16:52883414-52883436 CTTCACCCTGGGCCACACACAGG + Intergenic
1139446170 16:67000168-67000190 CCTACTCCTCGGCCACACTCTGG - Intronic
1139523334 16:67497809-67497831 GCTAACCCAGGGCCAGACTCTGG - Intergenic
1139546421 16:67651984-67652006 GCTGATCCCGGGCTGCACTCAGG - Exonic
1139915864 16:70428155-70428177 GCTCATTCTGAGCCTGACTCAGG - Intronic
1140992952 16:80232011-80232033 CCTCTTCCTGAGCCTCACTCGGG + Intergenic
1142149863 16:88507872-88507894 GGCCATCCTGGGCTCCACTCGGG + Intronic
1142382242 16:89739509-89739531 GCTGATCCGGGGCCACACGGAGG + Exonic
1143835044 17:9684882-9684904 ACTCATTCTGGGCCAGAGTCCGG + Intronic
1147039701 17:37709006-37709028 ACCCATCCTGGCCCCCACTCTGG + Intronic
1148242713 17:46010981-46011003 GCTTAGCCTGCGCCACCCTCTGG + Intronic
1149478939 17:56986072-56986094 GCACAGCGTGGGCCCCACTCAGG + Intronic
1149784528 17:59423926-59423948 GCATATCCTGGGCCAGATTCGGG - Intergenic
1150649147 17:66998668-66998690 GCTCACCCAGGGCCAGACCCTGG + Intronic
1151462152 17:74260770-74260792 GCTCTTCCTGGGCCACAGAGGGG + Exonic
1152545595 17:80998704-80998726 GCTAATCCTGGGCTACACCCTGG - Intronic
1152785415 17:82245516-82245538 GCTCTTGCTGCGCCACACTCTGG - Intronic
1154437946 18:14361011-14361033 GCACAGCTTGGGCCACACCCAGG + Intergenic
1156091278 18:33473772-33473794 GCTCATTCTGGGCCACTCTAAGG + Intergenic
1156493624 18:37511445-37511467 GCTCAGCCTGGGCCTCCCTCAGG + Intronic
1157623723 18:49031385-49031407 GCTCTTCCTGGGCCCCCTTCAGG + Intergenic
1157663988 18:49469978-49470000 CCTCATCCTGTGCCACAGCCAGG + Intergenic
1157700232 18:49757669-49757691 GCTCATCCAGAGCCACACATTGG - Intergenic
1157908633 18:51594108-51594130 GCTCAGCACTGGCCACACTCAGG - Intergenic
1160847554 19:1173264-1173286 GCTGCTCCCGGGCCCCACTCGGG + Intronic
1161726821 19:5934065-5934087 GCTCCCCCTGGGCCAGAGTCCGG + Intronic
1162001275 19:7746571-7746593 GCTCTCCCTGGGCCAGGCTCCGG - Intronic
1162003902 19:7765123-7765145 GCTCTCCCTGGGCCAGGCTCAGG + Intronic
1163006963 19:14402910-14402932 GCACATGCTGGGCCTCTCTCTGG + Intronic
1163008240 19:14409537-14409559 GCTCCTCCTGGGCCATGCCCCGG + Exonic
1164674601 19:30092976-30092998 GCTCTTCCTGGGCCTCTCTTGGG + Intergenic
1164761931 19:30734773-30734795 GCTCACCCTGGGCCAGACCCGGG + Intergenic
1165783905 19:38449780-38449802 GCTCACCCTGTTCCACACTGTGG - Intronic
1166011107 19:39943482-39943504 CCTCATCCTGTGCCACAGCCAGG - Intergenic
1166333910 19:42094056-42094078 GCTGATCCTGAGCCACAAGCAGG + Intronic
1168288738 19:55347043-55347065 GCGCTTCCGGGGCCGCACTCGGG - Exonic
925430062 2:3783732-3783754 GCTCCTGCTTGGCCACACTCCGG - Intronic
925801876 2:7609679-7609701 GCTCATCCTGGCCCAAAGACAGG + Intergenic
925972358 2:9114641-9114663 GCTCACTCTAGGCCACACTGTGG - Intergenic
927140502 2:20127041-20127063 GATCATTCTAGGCCAGACTCTGG + Intergenic
927962669 2:27250523-27250545 ACTCACCCTGGGCCACCCCCAGG + Intergenic
929788103 2:45006295-45006317 GCACAGCCTGGGCCACCCTCCGG - Exonic
930121684 2:47765916-47765938 CCTCATCCTCCGCCGCACTCTGG - Intronic
931711181 2:64989835-64989857 GCTCAGCCTGAGCCGCACGCAGG + Exonic
934619273 2:95794126-95794148 GCGCATCCTGGGTCACATCCAGG + Intergenic
934641619 2:96030431-96030453 GCGCATCCTGGGTCACATCCAGG - Exonic
935259857 2:101344645-101344667 CCACATCCTGGGCCACCCCCTGG - Intergenic
937639993 2:124201215-124201237 TCTCAGCCTGGACCACTCTCAGG + Intronic
938377934 2:130820681-130820703 ACTCATGCTGGGCCCCACGCTGG - Intergenic
942459499 2:176159564-176159586 CCCCAGCCGGGGCCACACTCGGG - Intronic
943015509 2:182505471-182505493 GCTTATTCTGGGCCAGACACAGG + Intronic
944550966 2:200844579-200844601 GCTCATCCTGGGCCACACTCAGG - Intergenic
948626581 2:239272930-239272952 GCTCATCGTGGGCAACTCTCTGG - Intronic
948688953 2:239690196-239690218 CCTCAGCCTGGGCCACTCCCGGG + Intergenic
1168764567 20:372973-372995 GCTCCACATGGGCCACTCTCAGG + Intronic
1169400901 20:5279339-5279361 GCTCATCCTGGGCTATCCTGTGG - Intergenic
1169579166 20:6999571-6999593 GCTCACACTGGGGCTCACTCAGG - Intergenic
1172002840 20:31793875-31793897 GCTCAACCTGTGCCACATTATGG + Exonic
1172438201 20:34945462-34945484 GTACAGACTGGGCCACACTCAGG - Intronic
1173800234 20:45890658-45890680 GGTCAACCTGGGCCACACCTGGG - Exonic
1174358921 20:50015860-50015882 GCTCATCCTAGGCCAATCCCAGG + Intergenic
1174406478 20:50306359-50306381 GCTCACCCTGTTCCACACACTGG - Intergenic
1175419349 20:58821599-58821621 GCACAGCCTGCCCCACACTCAGG - Intergenic
1176296426 21:5075806-5075828 GCTCACCCAGGGCCAGGCTCGGG + Intergenic
1179502491 21:41819200-41819222 GGGCTTCCAGGGCCACACTCTGG + Intronic
1179860623 21:44186315-44186337 GCTCACCCAGGGCCAGGCTCGGG - Intergenic
1179878830 21:44285124-44285146 TCTCACTCAGGGCCACACTCAGG + Intergenic
1180244866 21:46540167-46540189 GAACTTCCTGGGCCATACTCTGG + Intronic
1181030687 22:20147722-20147744 GCTCCGCCTGGGCCCCACTGGGG + Exonic
1181441153 22:22935802-22935824 GCTCCTCCTGGGCCACACCTGGG - Intergenic
1181464638 22:23104268-23104290 ACCCACCCTGGGCCACACTGGGG - Intronic
1182475221 22:30573495-30573517 GCTCATCCAGGCCCACACAGGGG - Intronic
1182704892 22:32270943-32270965 GCTCATCGTGAGCCCCGCTCAGG - Intergenic
1183530533 22:38351137-38351159 GGACAACCAGGGCCACACTCAGG - Intronic
1183784374 22:40021155-40021177 GCTCCTTGTGGGCCACACGCTGG - Intronic
1183975294 22:41508560-41508582 GCTGATCCTGGCTCCCACTCTGG + Intronic
1184769402 22:46588807-46588829 GCCCAGCCTGGGCCACATCCAGG - Intronic
1184778277 22:46633968-46633990 GTTACTCCTGGGCCACCCTCAGG + Intronic
1184849783 22:47113517-47113539 AATCACCCTGGGCCCCACTCTGG + Intronic
1185320869 22:50199844-50199866 GCTCAGTCTGGTCCACACTCTGG - Intergenic
1185371805 22:50464483-50464505 GCCCATCCTGGGCCACGCTCGGG + Intronic
952949346 3:38507382-38507404 GCTCATCCTGCTCCATCCTCTGG - Intronic
953417812 3:42732942-42732964 GACCAGCCTGGGCCACACACTGG - Exonic
954629008 3:52038245-52038267 GCTCAGCCTGGGCCAACATCAGG - Intergenic
954958991 3:54548164-54548186 GCAGGTCATGGGCCACACTCAGG + Intronic
955949224 3:64225323-64225345 GCTGATCCTGAGCCAGACCCGGG + Exonic
956121509 3:65970853-65970875 GCTGATCCTTAGCCACACTGTGG - Intronic
965729735 3:171758548-171758570 GCAAAACCTTGGCCACACTCTGG + Intronic
966942499 3:184755866-184755888 GCCCTTCCTGGCCCACACACAGG - Intergenic
968450861 4:675322-675344 GCCCGTGCTGGGCCACCCTCGGG + Intronic
969365110 4:6689790-6689812 GCTCTTGCTGGGCCGCACCCAGG - Intergenic
969861026 4:10035388-10035410 GCTCATCCTGGGCCACCCACAGG + Intronic
971352376 4:25864967-25864989 TGTCTTCCTGGGCCACGCTCCGG + Intronic
972719654 4:41683335-41683357 GCTCATACTGGAGCAGACTCTGG + Intronic
974953823 4:68614846-68614868 ACTCCTCCAGGCCCACACTCTGG - Intronic
976407727 4:84678819-84678841 GCTCTCCCTGGGCCCCACCCTGG - Intronic
980617518 4:135250371-135250393 GCTCAGCCTGGGACACATTGGGG + Intergenic
982324484 4:154115426-154115448 TCTCAGGCTGGGCCACACTGAGG + Intergenic
983851135 4:172582128-172582150 GCCCATCAAGGGCCACACACAGG - Intronic
984534151 4:180952254-180952276 CCTAATCCTGGGCCACTCTTAGG + Intergenic
985592176 5:771244-771266 GTTCAGCAGGGGCCACACTCAGG - Intergenic
986762642 5:10894328-10894350 GCTCAGCCTGGGGCTCCCTCGGG + Intergenic
986821043 5:11467141-11467163 GCACATCCAGGGCCACGCTATGG - Intronic
988872467 5:35406154-35406176 GCTGACCCTGTGCCACCCTCCGG + Intergenic
988934897 5:36071874-36071896 GTTCTTCCTGGGGCTCACTCTGG - Intergenic
989152899 5:38317825-38317847 CCTCATACTGGGCCAGAATCTGG - Intronic
989782792 5:45289565-45289587 ATTCATCCTTTGCCACACTCTGG - Intronic
990310806 5:54536118-54536140 GCTCAGCCTAGGCGGCACTCTGG + Intronic
990483592 5:56235842-56235864 GCTCACCCTGGGCCACTTTTTGG - Intergenic
992835706 5:80639348-80639370 AGCCATCCTGGGCCACACTGAGG + Intronic
994452129 5:99956010-99956032 GTTCATGCTGAGCCACCCTCAGG + Intergenic
999314916 5:150577006-150577028 GCTCAGCCTGAGCCACTCTGAGG - Intergenic
999330684 5:150671816-150671838 CCTCACCCGGGGCCTCACTCGGG + Exonic
1001167996 5:169389131-169389153 GCTCATCTTGGTTGACACTCGGG - Intergenic
1001673857 5:173496429-173496451 GGTCACCCTAGGCCCCACTCAGG + Intergenic
1001858632 5:175033921-175033943 GCTCATCCTGGCCCCCACTTCGG - Intergenic
1002576214 5:180175547-180175569 GCCACTCCAGGGCCACACTCGGG + Intronic
1003145638 6:3508130-3508152 GCTCAACCTTGGCCCCACTTAGG + Intergenic
1005878529 6:30034994-30035016 CCTCATCCTGGGCATCCCTCTGG + Intergenic
1006152292 6:31995979-31996001 CCTGCTCCTGGGCCAAACTCAGG - Exonic
1006158595 6:32028717-32028739 CCTGCTCCTGGGCCAAACTCAGG - Exonic
1006673985 6:35748988-35749010 GCCCATGCTGTACCACACTCTGG - Intronic
1007149544 6:39675163-39675185 GCTAATCCTGGGGCACACATAGG + Intronic
1007757088 6:44106862-44106884 GCTCAGCCTGGGCCCCACAGAGG + Intergenic
1007966749 6:46010412-46010434 GCCCATCCTGGCCAACACACTGG + Intronic
1008170773 6:48202757-48202779 TCTCATACTGGCCCACACTTAGG + Intergenic
1017739831 6:157397360-157397382 GCTCTCCCTGGGCTACAATCAGG + Intronic
1019553495 7:1616895-1616917 GCTCACCCGAGGTCACACTCAGG - Intergenic
1019742974 7:2684279-2684301 GGTCATCCTGGGTCAGAGTCAGG - Intronic
1020279231 7:6642008-6642030 GCTAAACATGGGCCACCCTCGGG + Intronic
1020756260 7:12207478-12207500 TATCATCCTGGTCCACACACAGG + Intergenic
1022872818 7:34497299-34497321 GCTCATCCTCAGCCACATTCAGG - Intergenic
1023343872 7:39251447-39251469 GCTCTTCCTCCTCCACACTCTGG - Intronic
1024258324 7:47556346-47556368 CCTCATCCTGAGACACACTAAGG + Intronic
1024482460 7:49878134-49878156 CCACAGCCTGGGCCACACTCAGG + Intronic
1024965745 7:55020421-55020443 GCTCATCCTGGCCAACACCATGG + Intronic
1027193087 7:76009283-76009305 GTTCATTCTGGGGAACACTCGGG - Intronic
1029118490 7:98251003-98251025 GCTCCTCATGGGCCACTTTCTGG + Intronic
1029548740 7:101225052-101225074 AGTCATCCTGGGCCACATGCAGG - Intergenic
1030450725 7:109707660-109707682 ACTCATCCTGGGAAACACTCAGG - Intergenic
1032455079 7:132067065-132067087 GCTCCTGCTGGGCTCCACTCTGG - Intergenic
1033172284 7:139094748-139094770 CCTAACCCTGGGCCACACCCTGG + Intronic
1035099330 7:156383255-156383277 GCTCCTCCTCGGCCACACTAGGG - Intergenic
1035335402 7:158124771-158124793 GGTCAGCCTGGGCCACGCTGGGG + Intronic
1036727469 8:11232355-11232377 GCTTATCCAGGCCCTCACTCAGG + Intergenic
1037884363 8:22588669-22588691 GCCCTCCCTGGGCCACACTCAGG - Intronic
1041545847 8:59041314-59041336 CCCCATCCTGAGCCTCACTCAGG + Intronic
1042467932 8:69149530-69149552 CCTTGTTCTGGGCCACACTCTGG - Intergenic
1046844967 8:118905409-118905431 GCTCATCCTGGGTAGCACCCAGG - Intergenic
1047533331 8:125696968-125696990 GACCATCCTGGGCCACGCTTCGG + Intergenic
1049033670 8:140057888-140057910 GCTCATCCTGGATCAGACGCTGG - Intronic
1049692027 8:143965657-143965679 GCTCCTCTTGGGCCTCACTGGGG + Intronic
1056796452 9:89662136-89662158 GCTCCTCCTGGGCTGCCCTCCGG - Intergenic
1057139721 9:92719066-92719088 GCTCATCCTGGGCCACACTCAGG + Exonic
1061034791 9:128107474-128107496 GCTGATCCTGGGCCGCAGCCTGG + Exonic
1061053748 9:128210855-128210877 CCTCTTCCTGGGCGACTCTCTGG + Intronic
1061164756 9:128915950-128915972 GCACAATCTGGGCCAAACTCTGG - Intronic
1061872561 9:133528568-133528590 GCTGGTCCTGGGCCACGCTGGGG + Intronic
1062001661 9:134218976-134218998 CCTCTGCCCGGGCCACACTCAGG + Intergenic
1062034739 9:134377982-134378004 GCTCAGCGTCGGCCACACCCAGG + Intronic
1062155710 9:135047049-135047071 GCTGATCCTGGGCAGCACTGGGG + Intergenic
1062341917 9:136097525-136097547 GCTTAGCCTGGGGCTCACTCAGG + Intergenic
1185922905 X:4114043-4114065 TCTCCTCCTGGGCCATCCTCAGG - Intergenic
1186384862 X:9099708-9099730 GCCCATCCTGAGCCACTCTGGGG - Intronic
1186399026 X:9239941-9239963 GCTCATCCTTGGCCATGCTGAGG - Intergenic
1188770448 X:34147553-34147575 GCTCACCCTGGGCCGCAGTGGGG + Intergenic
1190234068 X:48602613-48602635 TCTCAGCCTGGGCCACACATTGG + Intronic
1192222501 X:69207042-69207064 CCTCACCCTGGCCCTCACTCAGG - Intergenic
1202254441 Y:22906476-22906498 GCTCTTCTTGGGCAGCACTCAGG - Intergenic
1202407432 Y:24540225-24540247 GCTCTTCTTGGGCAGCACTCAGG - Intergenic
1202463350 Y:25129856-25129878 GCTCTTCTTGGGCAGCACTCAGG + Intergenic