ID: 1057140206

View in Genome Browser
Species Human (GRCh38)
Location 9:92722199-92722221
Sequence GTCTCAGAGGGACCCCTGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 110}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057140206_1057140209 -6 Left 1057140206 9:92722199-92722221 CCTGTCAGGGGTCCCTCTGAGAC 0: 1
1: 0
2: 1
3: 18
4: 110
Right 1057140209 9:92722216-92722238 TGAGACCCCATTAGAGACAGAGG No data
1057140206_1057140211 -4 Left 1057140206 9:92722199-92722221 CCTGTCAGGGGTCCCTCTGAGAC 0: 1
1: 0
2: 1
3: 18
4: 110
Right 1057140211 9:92722218-92722240 AGACCCCATTAGAGACAGAGGGG No data
1057140206_1057140210 -5 Left 1057140206 9:92722199-92722221 CCTGTCAGGGGTCCCTCTGAGAC 0: 1
1: 0
2: 1
3: 18
4: 110
Right 1057140210 9:92722217-92722239 GAGACCCCATTAGAGACAGAGGG No data
1057140206_1057140216 27 Left 1057140206 9:92722199-92722221 CCTGTCAGGGGTCCCTCTGAGAC 0: 1
1: 0
2: 1
3: 18
4: 110
Right 1057140216 9:92722249-92722271 CATCCCCGTCACAGACAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057140206 Original CRISPR GTCTCAGAGGGACCCCTGAC AGG (reversed) Intronic
900383781 1:2399836-2399858 TTCTGAGAGGGACCACTGACTGG - Intronic
900435444 1:2628774-2628796 GTCTCCGTGGGACCCCAGACTGG + Intronic
900888400 1:5431647-5431669 GTCTGAGAGGGACTCCCGAGTGG + Intergenic
901203095 1:7477732-7477754 TTCTCAGAGGGTCCCCTTGCAGG + Intronic
906097573 1:43234695-43234717 GTCTCAGAGGGACCCTTGATGGG - Intronic
907459386 1:54596278-54596300 CTCTCAGAGAGACCACAGACAGG - Intronic
907937676 1:59057319-59057341 CTCGCAGAGGGAGCTCTGACAGG + Intergenic
911194092 1:94976394-94976416 GTCTCAGATGGCCCCCAGAACGG + Exonic
915105276 1:153531423-153531445 CTCTCAGTGGGACCGCTGTCTGG - Intergenic
918360305 1:183750939-183750961 GTCCCAGAGGGGCACCTGCCAGG + Intronic
922090059 1:222387378-222387400 GTCTCAGAGGGACACACCACAGG - Intergenic
1064869737 10:19924155-19924177 GTCTCAGTCAGACTCCTGACTGG + Intronic
1065603570 10:27393496-27393518 GAGTCAGAGGGCCCCCTGTCTGG + Intergenic
1067790595 10:49284551-49284573 ATCTCACACGGACCCCTGCCTGG + Intergenic
1069628072 10:69880495-69880517 GTCTCCGGGGGACCCCTGCGGGG - Exonic
1069768206 10:70879467-70879489 GTGTCAGAGGGAGACCTGGCAGG + Exonic
1071564052 10:86662514-86662536 GTCTCAGAGGCAGCCCTGCCAGG - Intronic
1072032830 10:91537664-91537686 GTCTCATAGGGACCACAGACAGG + Intergenic
1072525496 10:96267583-96267605 GTCTCAGTGAGACCCCTACCAGG + Intronic
1072608859 10:97003718-97003740 GTCTCAGAGGGCCCCAAGACTGG + Intronic
1076527858 10:131123699-131123721 GGCTCAGAGCGGCCCCTGGCCGG - Intronic
1077141416 11:1026533-1026555 GTCTCAGAGGGGCCCAGGGCTGG - Intronic
1078066521 11:8082381-8082403 GTCTCTGGGGGGCCCCTCACAGG + Intronic
1085534992 11:77212317-77212339 GTCTATGTGGGACCCCTGCCAGG - Intronic
1087122456 11:94589299-94589321 GTCTCAGAGGTCCCCCAGATTGG + Intronic
1089516005 11:119031961-119031983 GTCTCAGCCAGACTCCTGACTGG + Intergenic
1091196317 11:133733826-133733848 GTGTCACAGGGACCCCTCAGAGG - Intergenic
1091285231 11:134405172-134405194 GCCTCAGAGGGACCCAGCACCGG + Intronic
1092569753 12:9709248-9709270 GTCCCAGAGGCACCCCCAACAGG + Intergenic
1101307728 12:103546344-103546366 CTTTCAGAGGGAACACTGACAGG - Intergenic
1103848650 12:123916921-123916943 GTCTCAGCGTGACTCATGACAGG - Intronic
1106388077 13:29307570-29307592 GTGTCAGAGGGCCCCCTCAAGGG + Intronic
1108523462 13:51265087-51265109 GCCTCTGAGTGAGCCCTGACTGG - Intronic
1114278860 14:21171498-21171520 GACTCACAGGCACCCCTGAAAGG + Intergenic
1115043138 14:28955776-28955798 GTCCCAGGGAGACACCTGACTGG - Intergenic
1115641817 14:35340114-35340136 CTCTGAGAGGGACCCCTGGAAGG - Intergenic
1119423504 14:74522007-74522029 GTGTCTGAGGGACCCCTGCAAGG - Exonic
1122048139 14:99037956-99037978 GCCTCAGATGGTCCCCTGTCGGG - Intergenic
1122660550 14:103292113-103292135 GTCTCAGATGCACCCCCCACTGG - Intergenic
1124175251 15:27418173-27418195 GGCTCACAGGGTCCCCTGGCCGG - Intronic
1124373800 15:29117866-29117888 GTCTCTGTGGGAGCCCTGCCCGG - Exonic
1127601160 15:60538262-60538284 GTCTCAGAGGGAGACCTGGAAGG - Intronic
1128513150 15:68326019-68326041 GTCTCAGGGGGCCCCTTAACAGG + Intronic
1129178391 15:73856322-73856344 GTTTCAGAGCAAGCCCTGACTGG - Intergenic
1132111126 15:99103048-99103070 GTCCCAGAGGGGCCCAGGACCGG + Intronic
1138337732 16:56266468-56266490 GGCTCAGAGGGACCACTGGTTGG - Intronic
1139465672 16:67152828-67152850 GACTCAGAAAGACCCCTGACTGG + Intergenic
1139712068 16:68783501-68783523 GTCTCAGATGAACTGCTGACAGG - Intronic
1145760063 17:27420733-27420755 CTCCCAGAGGGACTCCTGTCAGG + Intergenic
1148489349 17:48013132-48013154 GTCTCAGATGTACCCCCGGCTGG + Intergenic
1148821997 17:50365184-50365206 GACTCAGAGGGAACCCAGGCTGG - Intergenic
1150296020 17:64007975-64007997 TTCTCAGGGGAACCCCTGATGGG + Intronic
1150821237 17:68436029-68436051 GTCTCTGAGGCATCCCTGAGCGG - Intronic
1151199776 17:72459192-72459214 GTCTCTGAGGGTCCCCTCTCTGG + Intergenic
1151880230 17:76890192-76890214 GGCTCAGAGGGACCGAGGACAGG - Intronic
1153898176 18:9588321-9588343 ATCTCAAAGGGACCCATAACTGG + Intronic
1155236022 18:23820057-23820079 GTCTCAGGGAGCCCCCTGAAAGG + Intronic
1160756167 19:758087-758109 GTCTCGGAGGGTCCCCAGCCCGG + Exonic
1161651731 19:5489979-5490001 AGCCCAGAGGGACCCCTGTCAGG + Intergenic
1163646972 19:18495127-18495149 GTGACACAGGGACCCCTGGCAGG + Intronic
1168067356 19:53925705-53925727 GTCTCACAGGGACCTCTGCTGGG + Intronic
925205260 2:2000531-2000553 GTCTCAGAGGGACCACAGGGTGG + Intronic
926222818 2:10947508-10947530 GTGGCAGGGGGACCCCTGGCTGG + Intergenic
931530732 2:63211235-63211257 GTCTCAGAGGGGCACCTGGCCGG - Intronic
944413386 2:199462774-199462796 GCCTCAGAGGGACGACTGATGGG + Intronic
946167690 2:217875364-217875386 GTCTGAGAGGGAAGCCTGGCAGG + Intronic
948908271 2:240990120-240990142 GTCGCCCAGTGACCCCTGACAGG - Intronic
1170169317 20:13393465-13393487 GTGTCAGAGGGCCCCCTCAAGGG + Intronic
1170727250 20:18941226-18941248 GTCCCAGAGGGGCCCCTGCCAGG + Intergenic
1175161248 20:57009470-57009492 TTTACAGAGGGACCCCTGGCCGG - Intergenic
1175194712 20:57235011-57235033 GTTTGGGAGGGACCCCTGTCGGG - Intronic
1175493068 20:59392125-59392147 GTCTCAGAAGTAGCCCTGATTGG + Intergenic
1176085429 20:63293595-63293617 GACTCAGTGGGACCCCTGCCAGG - Intronic
1179575894 21:42308295-42308317 GTCTCTGAGGGACAGCTGAGTGG - Intergenic
1180157616 21:45985755-45985777 GTCTCAGAGGGCCACATGGCCGG + Intronic
1183982854 22:41552454-41552476 GTCACAGTGGGACTCCTGGCTGG + Intergenic
1184240576 22:43209520-43209542 GTCTCAAGAGGAGCCCTGACGGG + Intronic
1184445887 22:44546620-44546642 GCCTGAGAGTGACCCCGGACTGG - Intergenic
1185245170 22:49769574-49769596 GGCTCAGAGGTAGCACTGACCGG + Intergenic
949342503 3:3044979-3045001 GGCTCAGAGGGTCCCATGCCCGG + Intronic
953682579 3:45051013-45051035 GACTCAGAGGGAGCCATGGCTGG + Intergenic
954276800 3:49547478-49547500 GTCTCAGGCAGACTCCTGACTGG + Intergenic
955483041 3:59408607-59408629 TTTTCAGAGGGATCCCTGGCAGG + Intergenic
964878266 3:161394538-161394560 GTGGAAGAGGGACCCCAGACAGG - Intergenic
967999541 3:195195443-195195465 TTCTCAGTGGGACTTCTGACTGG - Intronic
969630828 4:8334992-8335014 GTTCCAGAAGGAACCCTGACTGG - Intergenic
974329477 4:60458913-60458935 GTCTCAGATGGCCACCTGACAGG - Intergenic
976790318 4:88870891-88870913 ATCTCAGAGGGGCACCTGGCTGG - Intronic
981538427 4:145824206-145824228 GTTTTAGAGGGAACCCTGGCAGG - Intronic
986332595 5:6728364-6728386 CTCTCAGAGGCACCGCTGCCAGG - Intronic
987063388 5:14263814-14263836 GCCTCAGAGGCATCCCTGACAGG + Intronic
987308928 5:16664341-16664363 GTCACAGAGGGAATCCTGAGAGG + Intronic
987923999 5:24317344-24317366 GTCCCAGAGGGGCACCTGCCAGG + Intergenic
992836849 5:80650168-80650190 GTATTAGAGGCACCCCTGCCCGG - Intronic
999243451 5:150140560-150140582 GACTCAGAGGGACCCCTTAGGGG + Intronic
1001643868 5:173265495-173265517 GCCCCAGAGGGGCCCCTGCCAGG - Intergenic
1001650298 5:173311172-173311194 TTTTCAGAGGGAGCCCTGGCAGG + Intergenic
1006415272 6:33899998-33900020 GTCTCAGAGGGGCCAGTGCCGGG + Intergenic
1011705333 6:89995484-89995506 GGCTCAGATTGACCCCTGCCCGG + Intronic
1012597033 6:101053528-101053550 GTCCCAGAGGGGCACCTGCCAGG + Intergenic
1014311354 6:119805883-119805905 CTCTCTAAGAGACCCCTGACAGG - Intergenic
1024692829 7:51821258-51821280 GTCTCAGCAGGACCCATGCCTGG - Intergenic
1026947934 7:74328112-74328134 GTTTCAGACGGACCCCTCCCTGG + Intronic
1029465233 7:100720951-100720973 GTCGCTGAGGGACCCCGGCCAGG + Exonic
1032455628 7:132071323-132071345 CTCAGAGAGGGACCCCAGACAGG + Intergenic
1034879399 7:154751835-154751857 ATCCCAGAGGGACCCCCCACCGG - Intronic
1035282224 7:157785439-157785461 GGCTCAGAGGGGCCCCAGGCCGG + Intronic
1036229148 8:6984811-6984833 GGCTCAGTGGGAGCTCTGACAGG - Intergenic
1036231601 8:7003916-7003938 GGCTCAGTGGGAGCTCTGACAGG - Intronic
1036993423 8:13626925-13626947 GTCCTAGACAGACCCCTGACAGG - Intergenic
1038083223 8:24163899-24163921 GTCCCAGAGGGGCACCTGCCAGG + Intergenic
1038898690 8:31817285-31817307 GTCTCACAGAGACTCCTAACAGG + Intronic
1040897689 8:52385838-52385860 GAGTCTGAGGGACCCCTGTCAGG + Intronic
1041303580 8:56437908-56437930 CTCTCAGAGGGAGCCCAGAGCGG + Intronic
1041375225 8:57205240-57205262 GACTGAGAGGGACACCTGACAGG + Intergenic
1041375456 8:57206596-57206618 GACTGAGAGGGACACCTGACAGG + Intergenic
1041376219 8:57210975-57210997 GACTGAGAGGGACACCTGACAGG + Intergenic
1041377166 8:57216375-57216397 GACGGAGAGGGACACCTGACAGG + Intergenic
1049781264 8:144430022-144430044 GTGTCAGAGGAGCCCCTGCCAGG + Intronic
1057140206 9:92722199-92722221 GTCTCAGAGGGACCCCTGACAGG - Intronic
1058439424 9:104993378-104993400 GTGTCACAGGAAACCCTGACAGG - Intergenic
1062058460 9:134481723-134481745 GTCTCAGAGGCAGCCATCACGGG + Intergenic
1062514051 9:136923200-136923222 GCCACAGAGGGAGCCCTGACCGG - Intronic
1186501118 X:10051431-10051453 GTCTCAGAGGGACCCTTGCTGGG + Intronic
1188230649 X:27659053-27659075 GTCTCAAATGTACCCCTGAGAGG + Intronic
1189594700 X:42551780-42551802 GTCTGAGAAGCACCCCTGGCTGG + Intergenic
1192202484 X:69075513-69075535 GGCTCAAAGGGACCCCAGAAAGG - Intergenic
1196322193 X:114354389-114354411 GTCTCAGACTGACCCCTGGGTGG + Intergenic
1199647911 X:149929133-149929155 GACTCAGATGGACCCCTCATGGG - Intergenic
1201543269 Y:15132274-15132296 GTCCCAGAGGGGCACCTGACAGG - Intergenic