ID: 1057140349

View in Genome Browser
Species Human (GRCh38)
Location 9:92722944-92722966
Sequence CTGGGCTCCCTCTCCTCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 632
Summary {0: 1, 1: 0, 2: 5, 3: 82, 4: 544}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057140349_1057140354 12 Left 1057140349 9:92722944-92722966 CCTGGAGAGGAGAGGGAGCCCAG 0: 1
1: 0
2: 5
3: 82
4: 544
Right 1057140354 9:92722979-92723001 GAGTGCACAGCGGACTGCAGAGG 0: 1
1: 0
2: 0
3: 10
4: 259
1057140349_1057140352 2 Left 1057140349 9:92722944-92722966 CCTGGAGAGGAGAGGGAGCCCAG 0: 1
1: 0
2: 5
3: 82
4: 544
Right 1057140352 9:92722969-92722991 CAGTATGCCAGAGTGCACAGCGG 0: 1
1: 0
2: 0
3: 14
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057140349 Original CRISPR CTGGGCTCCCTCTCCTCTCC AGG (reversed) Intronic
900074019 1:797525-797547 GTGGGATCCCCCTGCTCTCCAGG - Intergenic
900252105 1:1676287-1676309 CTGGGCTCCCCCGGCCCTCCCGG + Intronic
900262515 1:1739145-1739167 CTGGGCTCCCCCGGCCCTCCCGG + Intronic
900643765 1:3699485-3699507 CTGGCCTCCCTCTGGCCTCCTGG - Intronic
900660697 1:3781362-3781384 CTGGGTCACCTCTCATCTCCAGG - Intronic
901672582 1:10864863-10864885 CTGGGGTCCTTGTCCCCTCCTGG - Intergenic
901762324 1:11479208-11479230 TGGGGCTCCCCCTCCGCTCCAGG - Intronic
901871362 1:12140853-12140875 CTGGGCCTTCTCTCCCCTCCTGG + Intronic
902039078 1:13479861-13479883 CAGGGTCCCCTCTTCTCTCCTGG + Intronic
902820097 1:18938437-18938459 CTGGGTTCCCTCTCCCATGCTGG + Intronic
902856757 1:19211907-19211929 CTGTCCTCCCTTCCCTCTCCAGG + Intergenic
902897096 1:19486047-19486069 CTGGGCTCCTGCCCCGCTCCCGG - Intergenic
903018792 1:20379318-20379340 CTGGCAGCCCTCTCCTCTTCTGG - Intergenic
903212166 1:21824412-21824434 CTCGGCAGCCTCTGCTCTCCAGG - Exonic
903275153 1:22216897-22216919 CGGGGGTCCCTCTCAGCTCCTGG + Intergenic
903695592 1:25204205-25204227 CTTGGGTCCCTCAACTCTCCTGG + Intergenic
903974868 1:27142847-27142869 CTGGGGTCCTTCTCCTTGCCTGG + Intronic
903987056 1:27235687-27235709 TTGGGCTCTCTCTCCTCTGCGGG + Intronic
904013471 1:27403586-27403608 CTCTGCTCCCGCCCCTCTCCCGG + Intergenic
904200726 1:28817545-28817567 CTTGTCTCCCTCCCCTCTCTTGG + Intronic
904279580 1:29409438-29409460 CTGGCCCCTCCCTCCTCTCCAGG - Intergenic
904412050 1:30330446-30330468 CTCTCCTTCCTCTCCTCTCCCGG + Intergenic
904538616 1:31217743-31217765 CCAGGCTCCCTGTCCTCTCCTGG + Intronic
904558334 1:31380204-31380226 CTGGCCTCCATCCCCTCTTCTGG + Intergenic
904746962 1:32717304-32717326 CTGTGCCCCCTCTCCCTTCCTGG + Intergenic
905169163 1:36099318-36099340 CTGGGCCCCCTGGCTTCTCCCGG - Exonic
905519520 1:38587199-38587221 CTAGCCTCCCTCTCCACCCCAGG + Intergenic
905793518 1:40802615-40802637 CCGGGCTCCTTCTCCTCAGCAGG - Intronic
906518988 1:46456304-46456326 TTGGCCTCCCCCTCCTCCCCGGG - Intergenic
906633039 1:47388304-47388326 CTGGGAGCCACCTCCTCTCCCGG - Intergenic
907461633 1:54608887-54608909 CTGGGCTCCCACCCCTTCCCAGG + Intronic
907763804 1:57388542-57388564 CTGAGCCCCATCCCCTCTCCTGG + Intronic
909736218 1:78966207-78966229 CTGGCCTCTCTCTCCTGTTCTGG + Intronic
911670973 1:100607232-100607254 CCGGGCTCACTCTCCTCTGGAGG - Intergenic
912565416 1:110584164-110584186 TTGGGATACCTCTCCTCTGCCGG - Intergenic
912963215 1:114214337-114214359 ATGGGTTCCTTCACCTCTCCAGG + Intergenic
914332325 1:146683707-146683729 CTGGGCTGCCTCTCCTGTTCAGG + Intergenic
915356095 1:155255779-155255801 CAGGGCTCCCTGGCGTCTCCGGG + Intergenic
917587898 1:176446503-176446525 GTGCCCTCCCTCTCCTCTTCAGG + Intergenic
918003447 1:180520075-180520097 CTGGCCTCTCTCTCAACTCCAGG - Intergenic
918003452 1:180520103-180520125 CTGGGCTAGCTCCCATCTCCAGG - Intergenic
918071679 1:181137797-181137819 GTGGCCTCCCTCTACTCTCTTGG + Intergenic
918794415 1:188874310-188874332 GTGTGCTCCCTCTCCTCTCAGGG - Intergenic
919881630 1:201904810-201904832 CTGGGCTCCTTCTCCTTTTAAGG - Intronic
920003080 1:202812477-202812499 CTGCTCTTCCTCTCCTGTCCTGG + Intergenic
920052666 1:203173096-203173118 CTCCTCTCCCTCTTCTCTCCAGG + Intronic
920090534 1:203449877-203449899 CTTGGATCCCTCTTATCTCCTGG + Intergenic
920256687 1:204660166-204660188 CAGGACTCCTGCTCCTCTCCAGG + Intronic
920264478 1:204711696-204711718 TTGGGGACCCTCTCCTCTCCAGG + Intergenic
921042112 1:211442795-211442817 CTGGGCTCCCTTCACTGTCCAGG - Intergenic
922269872 1:224022430-224022452 GTGGGATCCCCCTGCTCTCCAGG - Intergenic
922421388 1:225463073-225463095 CAGGGCTTCCTCCCATCTCCTGG + Intergenic
922505515 1:226123369-226123391 AGGGGACCCCTCTCCTCTCCAGG + Intergenic
922532613 1:226356012-226356034 CTGTGCTCTCACTGCTCTCCTGG - Intergenic
922730184 1:227945516-227945538 CAGGCCAGCCTCTCCTCTCCGGG + Intronic
923106352 1:230856896-230856918 CTGGCTTCCCTCTCCTCTACAGG + Intronic
924645121 1:245870420-245870442 GTGGGCTCGCTTACCTCTCCTGG + Intronic
924707282 1:246510851-246510873 CGGGGCCCCCTCTGCCCTCCTGG + Intergenic
1062922658 10:1291837-1291859 ACAGGCTCCTTCTCCTCTCCTGG - Intronic
1063144970 10:3288641-3288663 CTGGGCTCTTTCTCCCGTCCAGG + Intergenic
1063372809 10:5532779-5532801 CATGGCCTCCTCTCCTCTCCAGG + Intergenic
1063466360 10:6247636-6247658 AACGCCTCCCTCTCCTCTCCTGG + Intergenic
1065974155 10:30827997-30828019 GTCGGCCCCCTCTCCTCCCCTGG - Intronic
1066047623 10:31607169-31607191 CTGGCCTGTGTCTCCTCTCCTGG + Intergenic
1066270676 10:33819978-33820000 CTGGTCTCCATCTCCTGACCTGG + Intergenic
1067187688 10:44044276-44044298 CTGGGCATGCTCTCCTGTCCTGG + Intergenic
1067685710 10:48465098-48465120 CTGAACTCCCTCAGCTCTCCTGG + Intronic
1067805354 10:49388336-49388358 CAGGGCATCCTCTCCTCCCCTGG + Intronic
1067835713 10:49639810-49639832 CTGCCCTCTTTCTCCTCTCCTGG + Intronic
1069792280 10:71030410-71030432 CTGGGCTGCCTCTCCGGTGCTGG + Intergenic
1069874248 10:71551945-71551967 CCGGGCACCCTCCCCTCTCAGGG + Intronic
1070183522 10:74037727-74037749 CTGGGCAGCTTCTCCTTTCCAGG + Intronic
1070771763 10:79086350-79086372 CTGGGCACCTTCTCTGCTCCAGG - Intronic
1070828250 10:79403663-79403685 CAGGGCCCCCTCCCCTCTTCTGG + Intronic
1070866803 10:79711984-79712006 CTGGCCAACCTCTCCTCCCCAGG + Exonic
1070891642 10:79945782-79945804 CTGGGCTCCATCTCCACACTGGG - Intronic
1070945957 10:80391840-80391862 GTGAGCTCCCTCTCCTCTTCTGG - Intergenic
1071089144 10:81898445-81898467 CTCAGATCCCTCTCATCTCCAGG + Intronic
1072193788 10:93097531-93097553 CTGTGCTCCAACTGCTCTCCCGG - Intergenic
1073057458 10:100711501-100711523 GTGGGCTCCCTCTGGGCTCCAGG + Intergenic
1073105460 10:101030134-101030156 CTGAGCTCCCTCTCCTCCCGAGG - Exonic
1073875341 10:107915256-107915278 CAGGAATCCCTCTCCTCTCCAGG - Intergenic
1074540836 10:114364184-114364206 CTGGGCTCCTGCTGCTGTCCAGG + Intronic
1075457225 10:122592612-122592634 TTGGGCTCCCTCTCCTAGACTGG + Intronic
1075519869 10:123136858-123136880 CTGGGATCCCCCTCCTCCCGAGG - Intronic
1075584879 10:123650532-123650554 CAGGTTTCCCTCTCTTCTCCTGG + Intergenic
1075874093 10:125792338-125792360 CTGGGCCCCCTCGCCTGGCCTGG - Intronic
1076600392 10:131653535-131653557 CTGTGCCCCCTCTGCTTTCCAGG - Intergenic
1076880585 10:133237524-133237546 CCGGGCGACCTCTCCTCTCCAGG - Exonic
1077324400 11:1957504-1957526 CTGTGCTGCCTCTCCTAGCCTGG + Intronic
1077411311 11:2405171-2405193 CTGGGCTCCCCATCTTCCCCAGG - Intronic
1077480558 11:2812558-2812580 CGGGGCTGGCCCTCCTCTCCGGG - Intronic
1079090058 11:17474666-17474688 CCGTGTTCCCTCTGCTCTCCTGG + Intronic
1079111235 11:17606278-17606300 CTGGGCCACCTCTCATCTCAGGG - Intronic
1080700238 11:34638458-34638480 CTGGGTGCCATTTCCTCTCCCGG - Intronic
1081897362 11:46598041-46598063 CTGGGCTCTCTCTCCTTCCCTGG - Intergenic
1083155488 11:60820513-60820535 CTGGGCTGCCTCATGTCTCCTGG - Intergenic
1083424373 11:62575527-62575549 CTGGGCTGCCCCTCTTCTCCAGG + Exonic
1083771818 11:64871771-64871793 GTGGCCTCCCTCTCCCCTCCAGG - Intronic
1083778003 11:64903551-64903573 CTGGGCTCCCTCCCCTCTGAGGG - Intronic
1084064099 11:66693548-66693570 CTCTGCTCCCTCTCCTAGCCTGG + Intronic
1084387430 11:68852875-68852897 TTTGCCTCCGTCTCCTCTCCTGG - Intergenic
1084792778 11:71485277-71485299 CAGTGCTCCCTCTGCCCTCCCGG + Intronic
1084970745 11:72770774-72770796 CTGGGTGCCGTCTCCTCTCCTGG - Intronic
1084973268 11:72782641-72782663 CTGGGCTCTCTTACCTCCCCAGG + Intronic
1085349614 11:75790133-75790155 CTGGGCTTCATCTCCCCTCTGGG - Intronic
1085624911 11:78064387-78064409 CACTGCCCCCTCTCCTCTCCTGG - Intronic
1085789729 11:79486620-79486642 GTGGGCTCACTCTCTTCTCCAGG + Intergenic
1086274567 11:85110549-85110571 CTGGGCTCCCTCTGCACTGCAGG + Intronic
1086341907 11:85855457-85855479 CTGCCCTCCTTCTCATCTCCTGG - Exonic
1087174598 11:95084828-95084850 CTCAGCTTCCTCACCTCTCCTGG + Intergenic
1088811960 11:113398097-113398119 CTGGCCTCCCCCTCATCCCCAGG + Intronic
1088877873 11:113950987-113951009 CTGGCCTCTCTCTCCTGTTCTGG - Intergenic
1089063729 11:115646327-115646349 CTGGGCTCCCTCTCCCGCCTCGG - Intergenic
1089185873 11:116614387-116614409 CTTGGGGCCCCCTCCTCTCCAGG + Intergenic
1089280561 11:117371390-117371412 CTTGGCTGCCTCTTCCCTCCTGG - Exonic
1089294658 11:117460434-117460456 CTGGGCCCTCTCTTCTTTCCTGG - Intronic
1089302953 11:117509582-117509604 CTGGGCTCTCTTCCCCCTCCAGG - Intronic
1089324222 11:117646284-117646306 CTGGGATTCCACACCTCTCCAGG - Intronic
1089399868 11:118158129-118158151 CTGGCCACCTTCTCCTCCCCTGG - Intergenic
1089583192 11:119494408-119494430 CTGTGCTGCCCCTGCTCTCCAGG + Intergenic
1089743431 11:120600610-120600632 CTGGGGACCCTCTCCCCACCAGG + Intronic
1089837761 11:121386344-121386366 CTGGGCTCTCTCACATGTCCAGG - Intergenic
1090602997 11:128391897-128391919 CTGGACTCTCTCTCCTCTTCAGG - Intergenic
1090848221 11:130547536-130547558 CTGGGCTCCCACTCAGCCCCTGG - Intergenic
1202807381 11_KI270721v1_random:12681-12703 CTGTGCTGCCTCTCCTAGCCTGG + Intergenic
1091744770 12:2984071-2984093 CTAGGCTCTTTCTCCACTCCTGG - Intronic
1091772610 12:3162855-3162877 CAGGGCTGCCTCAGCTCTCCCGG - Intronic
1092009164 12:5095101-5095123 ATGTGCTCCCTCACCTTTCCTGG - Intergenic
1092166878 12:6347922-6347944 CTGGGCCCCCGCCCATCTCCAGG - Exonic
1092997751 12:13966013-13966035 CGGGGCTCTTTCTCCTCTGCAGG - Intronic
1094314878 12:29128747-29128769 CTGGCCTCTCTCTCCTTTCTGGG - Intergenic
1094476289 12:30843244-30843266 CTTGCCTCCCTCACCCCTCCTGG - Intergenic
1095114021 12:38331054-38331076 CTGGTCTCCAGCTCCTATCCGGG - Intergenic
1095933056 12:47648653-47648675 CTAGGCTTCCTCTCCACCCCAGG - Intergenic
1096505147 12:52087940-52087962 CTGGGCTCCCTGCCCTTCCCTGG + Intergenic
1096654274 12:53079049-53079071 CTGGGCCCTGTCTCCTCCCCGGG + Intronic
1096683163 12:53270281-53270303 CTGGGCTCTGTCAGCTCTCCAGG + Intronic
1096734594 12:53642804-53642826 CTGTGATCCCTCTCCTCTGTAGG + Intronic
1096869543 12:54584782-54584804 CTGGGCTCCTCCCCCTCCCCTGG + Intronic
1097180988 12:57171816-57171838 CAGTGCTCCTGCTCCTCTCCTGG + Intronic
1097687260 12:62702792-62702814 CTTGGCTGCCTCTTCTCCCCTGG + Intronic
1098024715 12:66189452-66189474 CTGGGCTCCCCCGCCGCCCCCGG - Intronic
1099396968 12:82152142-82152164 TTGGGCTCCTGCTCCTTTCCTGG - Intergenic
1099418798 12:82426761-82426783 CTGGGATCCCTCTTGTTTCCAGG - Intronic
1101663957 12:106792854-106792876 CTGTTCTCCCTCTCTTCTCTTGG + Intronic
1102769052 12:115457479-115457501 CTAGGCTCTTTCTCATCTCCAGG + Intergenic
1102799534 12:115719419-115719441 CTGGGCCCTTTCTCCTCTCCAGG - Intergenic
1103320639 12:120090882-120090904 CTGCTCTCTCTCTTCTCTCCCGG + Intronic
1103852308 12:123941114-123941136 CCTCGCTCCCTGTCCTCTCCTGG - Intronic
1103931937 12:124455404-124455426 CTGGGCTCCCCCACCCCTTCAGG - Intronic
1103979197 12:124725473-124725495 CTGCACTCCGTCACCTCTCCGGG + Intergenic
1104365309 12:128171385-128171407 CTCTCCTCCATCTCCTCTCCTGG - Intergenic
1104849026 12:131862332-131862354 CTGGGCTCGCTCTGCTGCCCAGG + Intergenic
1104901475 12:132191710-132191732 CTGGGCGCCCTCTCCTCACTGGG - Intergenic
1105284648 13:18994230-18994252 CTGGCCTCTGTCTTCTCTCCTGG - Intergenic
1105964551 13:25372395-25372417 CTGGGCTCCCTGGGCTCTCTGGG + Intronic
1107398850 13:40048676-40048698 CTTGGCTCCTGCTCATCTCCGGG - Intergenic
1107689322 13:42936192-42936214 CTAGTCTTCCCCTCCTCTCCTGG + Intronic
1108042788 13:46355057-46355079 CTGGGCTTCCTCTCCTACACTGG - Intronic
1108463638 13:50693087-50693109 CTTGCCTCCCTCTTATCTCCTGG - Intronic
1109140168 13:58704708-58704730 CTGGTCTCACTCTCTTGTCCAGG - Intergenic
1109262177 13:60157929-60157951 TGTGGCTCCTTCTCCTCTCCAGG + Intronic
1109392624 13:61711913-61711935 CTTGGCTCCATCAGCTCTCCTGG + Intergenic
1109450826 13:62512473-62512495 CATGACCCCCTCTCCTCTCCAGG + Intergenic
1110281424 13:73698304-73698326 CTTGTCTACCTCTCCTCCCCAGG - Intronic
1110639571 13:77806604-77806626 CTGGGCTCTCTTTCTGCTCCTGG + Intergenic
1111949974 13:94702569-94702591 CTGCGCTCACTCAACTCTCCGGG - Intergenic
1111951766 13:94713481-94713503 CTGGGCTCCACCTCCTCCGCAGG - Intergenic
1112567496 13:100563886-100563908 CTGGGCTCACGCTCCTTGCCTGG - Intronic
1113231593 13:108218413-108218435 CTGTTCTCCGTCTCCGCTCCCGG - Exonic
1113296177 13:108961161-108961183 CTTCACTCCCCCTCCTCTCCAGG - Intronic
1113394774 13:109937025-109937047 CTGGGCTCACTCTCTTCACTTGG - Intergenic
1113511974 13:110863652-110863674 GTGAGCGGCCTCTCCTCTCCAGG + Intergenic
1113654852 13:112061588-112061610 CTGGGCTTCCACCCCTCGCCAGG - Intergenic
1113910244 13:113838281-113838303 CTGGGCTCCCTCCCTGCTCCAGG - Intronic
1113910264 13:113838359-113838381 CTGGTCTCCCTCCCTGCTCCAGG - Intronic
1113910293 13:113838439-113838461 CTGGGCTCCCTCCCTGCTCCAGG - Intronic
1113910325 13:113838520-113838542 CCGGGCTCCCTCCCTGCTCCAGG - Intronic
1113910357 13:113838601-113838623 CCGGGCTCCCTCCCTGCTCCAGG - Intronic
1113910388 13:113838682-113838704 CCGGGCTCCCTCCCTGCTCCAGG - Intronic
1113910442 13:113838881-113838903 CTGGGGTCCCTCTCTGCTCCAGG - Intronic
1114163122 14:20190988-20191010 AAAGGCTACCTCTCCTCTCCAGG + Intergenic
1114268788 14:21088984-21089006 CTCATCTCCCTCTTCTCTCCTGG + Intronic
1114568189 14:23647585-23647607 CCAGGCTCCCGCTCCTTTCCAGG + Intergenic
1114671903 14:24415932-24415954 CGGGGCTTCCTCTCCTCTGATGG + Exonic
1114688222 14:24555267-24555289 CTGGGCACCCAGTCTTCTCCAGG + Intergenic
1115147117 14:30238804-30238826 GAGGGCCCCCTCTCCTCACCAGG + Intergenic
1115420103 14:33184318-33184340 CTTCTCTCACTCTCCTCTCCAGG - Intronic
1118902466 14:69998106-69998128 CTAGTCTCCCTCTCTGCTCCTGG + Intronic
1121280096 14:92691881-92691903 GAGGGCTCCCTGGCCTCTCCTGG + Intergenic
1121839248 14:97118888-97118910 TTGGCCTCCCACTCCTCTCTGGG - Intergenic
1122407250 14:101507954-101507976 CAAGGCTCCCGCTGCTCTCCAGG - Intergenic
1122556901 14:102585426-102585448 CAGGAGGCCCTCTCCTCTCCTGG + Intergenic
1122889864 14:104727265-104727287 CTGGGCGGCCTCCCTTCTCCAGG + Intronic
1122893094 14:104742027-104742049 CTGGCCTCCCTGTCCTCCCACGG - Intronic
1122974479 14:105165454-105165476 CCTGGCTGCCCCTCCTCTCCTGG - Intronic
1123582664 15:21730734-21730756 CTGGGCACCCTCTGGTTTCCTGG + Intergenic
1123619314 15:22173330-22173352 CTGGGCACCCTCTGGTTTCCTGG + Intergenic
1123734750 15:23174973-23174995 CTGGTCTCCTGCTCCTCACCTGG - Intergenic
1124017088 15:25886600-25886622 CTGGGTCTCCTCTCCTCTCCCGG + Intergenic
1124156020 15:27225885-27225907 CTGGGCTCCTCCTCCTCCCCTGG - Intronic
1124285252 15:28396271-28396293 CTGGTCTCCTGCTCCTCACCTGG - Intergenic
1124297444 15:28515343-28515365 CTGGTCTCCTGCTCCTCACCTGG + Intergenic
1124465511 15:29935949-29935971 CAGGGTTCCCTCTCCTTTTCTGG + Intronic
1125064657 15:35468363-35468385 CTGAGCTGCCTATCCACTCCAGG + Intronic
1125510137 15:40288343-40288365 CTGGGCTCAGTTTCCTCACCTGG - Exonic
1126302161 15:47209691-47209713 CTGGTCCCCGTCGCCTCTCCAGG + Intronic
1126414766 15:48406286-48406308 CTGGCTTCCGTGTCCTCTCCTGG + Intergenic
1128328071 15:66737933-66737955 CAGGGTTCCCTCTCCTAACCAGG - Intronic
1128594446 15:68930864-68930886 GGGGTGTCCCTCTCCTCTCCTGG + Intronic
1128648772 15:69395742-69395764 CTGCGCTGCCTCACCTCTCCGGG + Intronic
1129268550 15:74407772-74407794 CTGAGTTCCCTGTCCTCTCTGGG - Intergenic
1129375384 15:75126985-75127007 CTGGGTTCACTTTCCTCTCTTGG - Intergenic
1129525693 15:76212695-76212717 CAGGGCTCCCACTGCTATCCTGG + Intronic
1129656032 15:77526409-77526431 CTGTGGTCCCTCTCCTCACAGGG - Intergenic
1130752572 15:86728084-86728106 CTTGGTTCCCTCTCCTTTCTTGG + Intronic
1132578167 16:673401-673423 CTGGGCACCCTCCCATGTCCTGG - Intronic
1132596295 16:751999-752021 CAGGGCAGCCTCTTCTCTCCAGG + Intronic
1132641762 16:981467-981489 CGGCGCTTCCTCTCCTCTGCGGG - Intergenic
1132651578 16:1023596-1023618 CCTGGCTCCTTCTCCTCTTCCGG + Intergenic
1132702765 16:1229115-1229137 CTGGGCTCCCTCTGGGCTCCAGG - Intronic
1132705561 16:1241753-1241775 CTGGGCTCCCTCTGGGCTCCAGG + Intronic
1132826231 16:1907072-1907094 ATGGGGTCCCTGGCCTCTCCTGG + Intergenic
1132844547 16:1993785-1993807 CAGGCATCCTTCTCCTCTCCTGG - Exonic
1133119064 16:3595292-3595314 CTGTGGTCCCTCTACACTCCTGG + Intronic
1133770457 16:8864706-8864728 CTGGGCTCCCTCCCTTGGCCGGG - Intronic
1133806363 16:9128501-9128523 ATGGGCTCCCTCGCCTGTCCTGG + Intergenic
1134037255 16:11040412-11040434 CTCGGCTCCATCGGCTCTCCTGG - Intronic
1134250002 16:12567809-12567831 CTGAGCACCCTCTGCTCTCACGG + Intronic
1135149454 16:19992757-19992779 CTGGGCTGTCTCTTCTCTGCTGG + Intergenic
1135288747 16:21216650-21216672 CTGGCAACCCTCTCCTTTCCTGG - Intergenic
1139195637 16:64915536-64915558 CTGGCTTCCCTCAGCTCTCCAGG - Intergenic
1139471236 16:67179211-67179233 CTGGGCTCGCTCTCATCTCTTGG - Intronic
1139754465 16:69132044-69132066 CTGGGCTCCCTCCCAACCCCGGG + Intronic
1140001228 16:71027212-71027234 CTGGGCTGCCTCTCCTATTCAGG - Intronic
1140686046 16:77434871-77434893 CTGCGCGCCCTCCCTTCTCCCGG + Exonic
1141435478 16:83997379-83997401 CTGGGCGACATCTCCCCTCCTGG - Intronic
1141509682 16:84504469-84504491 CTGGCCTCCCACGCCTCTTCAGG - Intronic
1142004911 16:87685108-87685130 CTGGGCTCCTCATCCTGTCCTGG - Intronic
1142032301 16:87844626-87844648 CTGGGCAGGCTCTTCTCTCCAGG - Intronic
1142224702 16:88871838-88871860 ATGGGGTCACCCTCCTCTCCTGG + Intergenic
1142415526 16:89939095-89939117 CGGGGCTCCCTCTGCTCTGATGG - Intergenic
1142837104 17:2594634-2594656 CCGGGCTGCCTCTCCTCGGCGGG - Intronic
1143115073 17:4577462-4577484 CTGGACTCAGTCTCCCCTCCTGG + Intergenic
1143477139 17:7209135-7209157 CTGGTCTCCCTCTGCTCTTTTGG + Intronic
1143671610 17:8399911-8399933 CCTGGCTCCGTCTCCTCTCTGGG - Intergenic
1143724588 17:8836533-8836555 CTGGGGCCACTCACCTCTCCTGG + Exonic
1144384208 17:14733922-14733944 ATGGGTTCCATCTCCTTTCCAGG - Intergenic
1144620154 17:16813519-16813541 CATGTCTGCCTCTCCTCTCCTGG - Intergenic
1144871948 17:18377334-18377356 CAGGACACCCCCTCCTCTCCTGG + Intergenic
1144892532 17:18502183-18502205 CGTGTCTGCCTCTCCTCTCCTGG + Intergenic
1145018328 17:19412910-19412932 CAGGGGCCCCTCTCTTCTCCTGG + Intronic
1145139682 17:20442104-20442126 CGTGTCTGCCTCTCCTCTCCTGG - Intergenic
1145810631 17:27761897-27761919 CACGTCTGCCTCTCCTCTCCTGG + Intronic
1146260153 17:31415664-31415686 CTGAGCTCCTTCCCCTCTCTCGG - Intronic
1147134568 17:38427764-38427786 CTCGACTCCCCCTCCTCTCTGGG + Intergenic
1147424990 17:40342120-40342142 CTGCGCGCCCCCTCCCCTCCGGG - Intronic
1148046727 17:44749208-44749230 CTGGGCCCCCCAGCCTCTCCAGG + Intronic
1148080286 17:44964165-44964187 CTGGGCTCTGCCTCCTCTCCGGG - Intronic
1148187798 17:45657181-45657203 CAGGTCTCACTCTCCTGTCCAGG + Intergenic
1148357006 17:46982160-46982182 CTGGACTCCCTGTTCTATCCTGG - Intronic
1149185076 17:53988462-53988484 CTGGGCTCCCCTTCCAATCCTGG + Intergenic
1151749346 17:76027732-76027754 CAGGACACCCCCTCCTCTCCTGG - Intergenic
1152247328 17:79191867-79191889 CTGGGCAGCCTCTTCCCTCCCGG + Intronic
1152439615 17:80298074-80298096 CTGAGATCCCTCCCCTGTCCTGG + Intronic
1152683440 17:81682003-81682025 CTGTGCTCCCTCTCAGCTCAGGG + Intronic
1152768908 17:82155750-82155772 CTGGGCCCGCCCTCGTCTCCAGG + Intronic
1153006913 18:505070-505092 CTTGGCACCTTCTCCACTCCAGG + Intergenic
1153355896 18:4134881-4134903 CTGGGCTGCTTTTCCTCTCTAGG - Intronic
1155461781 18:26091136-26091158 TTGACCTCCCTCCCCTCTCCGGG - Intronic
1155833122 18:30543149-30543171 CTGGTCTCCATCTCCTGACCTGG + Intergenic
1157477390 18:48032001-48032023 CTGGGCTCCCTCACCAGGCCTGG + Intronic
1158247760 18:55451356-55451378 CTGGCATCCCTGTCCTCACCTGG + Intronic
1158427872 18:57354380-57354402 CTGTGCTCATGCTCCTCTCCAGG + Exonic
1160671953 19:369549-369571 CTGAGCTCCCTCTCCCCACCCGG + Intronic
1160698758 19:496657-496679 CTGGGCCCCCTCCTCTCTCCCGG - Intronic
1160698768 19:496676-496698 CTGAGCCCCCTCCCCTCTCCTGG - Intronic
1160698994 19:497335-497357 CCGGGCCCCCTCCCCTCTCCCGG - Intronic
1160898092 19:1412228-1412250 CTGGACTCCCTCTCCCCAGCAGG - Intronic
1161764460 19:6198985-6199007 CCGGGCGCCGTCTCCTCCCCAGG - Intronic
1162152681 19:8656882-8656904 CTGGACTCCCCCACCTCCCCTGG - Intergenic
1162831295 19:13286385-13286407 CTGGCCTCAGTCTCCTCCCCTGG - Intronic
1163358644 19:16830987-16831009 CTGAGCTCCCTGTTCCCTCCTGG - Intronic
1163441478 19:17324414-17324436 CAGGCCTCCCTCATCTCTCCTGG + Intronic
1163804222 19:19386278-19386300 CTGGGCCCCCCCGCCTCTCCAGG + Intronic
1164566947 19:29332737-29332759 CAGGGCTCCTTCTCATCTTCAGG - Intergenic
1164703120 19:30300340-30300362 CTGGGGTCTCTTTGCTCTCCAGG + Intronic
1164715144 19:30385452-30385474 CAGTGCTTCCTCTCTTCTCCTGG + Intronic
1164916033 19:32053043-32053065 GTGGGCTCACCCTTCTCTCCAGG - Intergenic
1165086109 19:33348697-33348719 ATGGGCTCTCTCTCTTGTCCTGG - Intergenic
1165169419 19:33880999-33881021 GTGGGCTCCCTCTTCTCCCCGGG + Intergenic
1165202464 19:34156295-34156317 GAGGTCTCCCTCTCCTGTCCAGG - Intergenic
1165412086 19:35668269-35668291 CTGGGCTGTCTCTTCTCTCCTGG + Intronic
1165931034 19:39358866-39358888 CTGGCCTCCCTCATCTCCCCAGG + Intronic
1166298110 19:41898449-41898471 CCCGGCTCCCCCTCATCTCCAGG - Exonic
1166371248 19:42302459-42302481 CAGGGCGCCGCCTCCTCTCCAGG + Exonic
1166542339 19:43613772-43613794 CTGTGCTCTCTCTCCTCGCTGGG - Exonic
1166663818 19:44665060-44665082 CTGGGCCCACTCTCCATTCCTGG - Intronic
1166792241 19:45405128-45405150 CTTGGCTCCCCCTCCCCACCGGG - Intronic
1167467767 19:49659134-49659156 CTGGGCACTGTCACCTCTCCTGG - Intergenic
1167684978 19:50950437-50950459 CTGGTCTCCCTCCCATCCCCAGG - Intronic
1167757554 19:51421917-51421939 GTGGGCTCTCCATCCTCTCCAGG - Intergenic
1168333164 19:55581007-55581029 CTGCCTTCCCTCCCCTCTCCAGG - Intergenic
1168645277 19:58055485-58055507 GTGGGCTCCAGCTCCCCTCCTGG + Intergenic
925022877 2:585675-585697 CTGGGCTCATTCTCCTGCCCTGG + Intergenic
925064942 2:922369-922391 CTGGGCACTCACTCCTCTGCTGG - Intergenic
925274416 2:2638597-2638619 CTGGGCTGCCTCCTCTCTTCTGG - Intergenic
925567416 2:5271297-5271319 CTGGTAACCCACTCCTCTCCAGG + Intergenic
926077233 2:9951413-9951435 CAGCGCTCCCTCTCCTGTCAGGG + Intergenic
926329869 2:11815474-11815496 CTGCGCCTCCCCTCCTCTCCAGG + Intronic
926784907 2:16509230-16509252 CAGGGCTCCCTCTCCTGGGCTGG + Intergenic
926808309 2:16733605-16733627 CAGGGCTCCCCCTTCACTCCAGG - Intergenic
927869079 2:26612515-26612537 CTGGCCTCCCTCCCCTCCCAGGG + Intronic
928082541 2:28323764-28323786 CTGGGCTTCCTTTGCTCTTCTGG + Intronic
928182562 2:29079924-29079946 CTGGGCTCCTTCTGCTCACTTGG + Intergenic
928372449 2:30750474-30750496 CTAGGCTCTCTCTCCTTTCATGG - Intronic
930762255 2:55049856-55049878 CCGGCCTCCCCCTCCTCCCCCGG - Exonic
931226687 2:60337934-60337956 CTGGGCTCCTTCTAGTTTCCTGG + Intergenic
931239779 2:60441716-60441738 CTGGGCTCCCACTCTTCTCCTGG - Intergenic
932614764 2:73224952-73224974 CTGGTCCCCCTCACCTCTCCTGG - Exonic
932703443 2:74005910-74005932 CTGGGCACTCACTCCTCTCCAGG - Intronic
933807684 2:86012032-86012054 CAGGGGTCCCTCTCCTCACTTGG - Intergenic
934554666 2:95281068-95281090 CTGGGTTCTCCCTCCTCTCCAGG + Intronic
934646182 2:96060495-96060517 CTTGGATGGCTCTCCTCTCCTGG - Intergenic
935101770 2:100002665-100002687 CCTGGCTTCCTCTGCTCTCCTGG + Intronic
935832847 2:107018636-107018658 CTGGACTCAGTCTCCTCCCCAGG - Intergenic
935975154 2:108570822-108570844 TTGGCCTCCCTTTCCCCTCCAGG - Intronic
936269323 2:111036673-111036695 CTGGACTCCCTCGACTCCCCAGG - Intronic
937150575 2:119683112-119683134 ACTGGCTCACTCTCCTCTCCAGG - Intronic
937265439 2:120612202-120612224 CCGTGCACCCTCTCCTCTCCAGG + Intergenic
937265954 2:120614784-120614806 CTGCCCTCCCTGTCCTCTCAGGG - Intergenic
937346173 2:121126960-121126982 CTGGGCCCCCTGGCCTCTTCAGG - Intergenic
937451997 2:122009763-122009785 CTTGGGCCCCCCTCCTCTCCTGG + Intergenic
937493852 2:122397821-122397843 CAGGGCTTACTGTCCTCTCCTGG - Intergenic
938185730 2:129230316-129230338 CTGCAGTCCCCCTCCTCTCCTGG + Intergenic
938512572 2:131966405-131966427 GCCGGCTCCCTCTGCTCTCCGGG + Intergenic
938695171 2:133828382-133828404 CTGGACTCCCTCTCTTTTTCTGG - Intergenic
938713018 2:133991843-133991865 CTGGGCTCCCTCTTTCCTCCAGG - Intergenic
942013737 2:171790221-171790243 CTGGGCTCATTCTCCTCTGGAGG - Intronic
942114202 2:172712370-172712392 CTGGGCTCTTTCTGCTCTCTTGG + Intergenic
942799630 2:179861039-179861061 CTGGGCGCCCTCTGCTTGCCCGG - Intronic
944934794 2:204556615-204556637 GTGTGCACCCACTCCTCTCCAGG - Intronic
945218756 2:207463334-207463356 CTGGTCTCTCTCTCCTGACCTGG - Intergenic
946230951 2:218291089-218291111 CTGGGCTCAGCCTCCTCCCCTGG - Intronic
946433597 2:219638291-219638313 GTGGGCTCCCTCTCCTGGCCTGG - Intronic
946919233 2:224560696-224560718 CTGGTCTCCATCTCCACTCCTGG + Intronic
947574555 2:231262324-231262346 ACGGTCTCCCTCTGCTCTCCAGG - Exonic
947607446 2:231497081-231497103 CTGGGACCCCTCACCTCTCCAGG + Intergenic
947911518 2:233803846-233803868 CTGGGCTCCCTCCCCACCCCAGG - Intronic
948207106 2:236168175-236168197 CCGGGCGCCCTCTCCACTCCGGG - Exonic
948280149 2:236740753-236740775 CTGGTCTCCCTAACCTCTCCAGG - Intergenic
948551007 2:238772976-238772998 CTGGGGTCCCTCCCATCCCCAGG - Intergenic
948608100 2:239148755-239148777 CTGGCCCCCGCCTCCTCTCCCGG - Intronic
948750761 2:240131497-240131519 CTGGTTTCCCTCTGCTCTCAAGG - Intronic
948788620 2:240365749-240365771 GTGGGCACCCACCCCTCTCCTGG + Intergenic
948884770 2:240877155-240877177 CCAGGCCCCCTCTCCTCTCAGGG - Intronic
948965053 2:241372748-241372770 CTGGGCTCTCTTGCCTCTGCTGG + Intronic
949007729 2:241659345-241659367 GTGGCCTCGCTCTCCTATCCCGG + Intronic
949043109 2:241858478-241858500 CTGGGCCCCAACTCCTCCCCTGG - Intronic
949049952 2:241892331-241892353 CTGGCGTCCCTCTCCTCTCCTGG + Intergenic
1168784614 20:527422-527444 CTTGCTTCCCACTCCTCTCCAGG + Intronic
1168880804 20:1204595-1204617 CTGAGCTGCCTCCTCTCTCCTGG - Intronic
1169027091 20:2380476-2380498 TGTGGCTCCCTCTCCCCTCCTGG - Intergenic
1169872646 20:10263909-10263931 TTGGGGCCCCTCTTCTCTCCTGG + Intronic
1170390276 20:15865773-15865795 CTGGGCTCCCTGCCACCTCCAGG - Intronic
1170630244 20:18058818-18058840 CTTCTCTCCCTCTCCCCTCCAGG - Intronic
1172136689 20:32690924-32690946 CTGGGCTCCCACTCAGCCCCTGG - Intergenic
1172189957 20:33055992-33056014 CTGGCCTGCCTCTACTCTACAGG + Intronic
1172496992 20:35394516-35394538 CTCTAATCCCTCTCCTCTCCTGG - Intronic
1173005695 20:39138141-39138163 CTGAGCTCCCCTTCCTCGCCAGG - Intergenic
1173201869 20:40960601-40960623 CTGGGCTCCCCCTCTCCACCTGG - Intergenic
1173816176 20:45989916-45989938 CTGGACTCCCTATCCTGTCCTGG + Intergenic
1174085964 20:48007165-48007187 CAAAGCTCCCTCTCCTCCCCTGG - Intergenic
1174130299 20:48339822-48339844 CAAAGCTCCCTCTCCTCCCCTGG + Intergenic
1175412214 20:58777764-58777786 CTGGGCTCCCTCCCACCTCGTGG + Intergenic
1175424849 20:58856826-58856848 CTCGGTGCCCTCCCCTCTCCAGG + Intronic
1175618955 20:60427113-60427135 CTGGGCTCACTGCCCTCCCCTGG - Intergenic
1175935989 20:62514256-62514278 CTGGGCACCCTTCCCTCCCCTGG - Intergenic
1175987567 20:62771542-62771564 CTGGGGTCTCTGCCCTCTCCGGG + Intergenic
1176143931 20:63557165-63557187 CTGAGCTCCCTCTCTCCTCCAGG + Intergenic
1177668290 21:24190938-24190960 CTAAGCTCCCTCCCCTCACCAGG + Intergenic
1177900817 21:26913128-26913150 CTGGGTTCCCCTCCCTCTCCAGG - Intergenic
1178011047 21:28287642-28287664 CTGGGCTAACTCTCCTCTTCTGG + Intergenic
1178521163 21:33289448-33289470 GAGGGCCCGCTCTCCTCTCCCGG + Intronic
1178695346 21:34787959-34787981 GTGGGCCGCCTCCCCTCTCCTGG - Exonic
1178953793 21:37006294-37006316 CGGGCCTCGCTTTCCTCTCCCGG + Intronic
1179245539 21:39630961-39630983 GCGTGCTTCCTCTCCTCTCCAGG - Intronic
1179655370 21:42841503-42841525 CTGGGGCCCCTCTCCTCTGCAGG + Intergenic
1180100496 21:45581691-45581713 CTGGGCTCCCTCTCCCCACATGG - Intergenic
1180167168 21:46036180-46036202 CTGGGCCGCCTCACCCCTCCGGG - Intergenic
1180899391 22:19359604-19359626 CTGCCCTCCCTCTCCTCTCTTGG - Intronic
1182106414 22:27693098-27693120 CTCAGCTCCCTCTCCTCACAGGG + Intergenic
1182283426 22:29231091-29231113 CTGGGGTCCCCCTCCTGCCCAGG + Exonic
1182578793 22:31291425-31291447 TGGGCCTCCCTCTCCTCTCGTGG + Intronic
1183525080 22:38317769-38317791 CCAGGATCTCTCTCCTCTCCAGG + Intronic
1184242783 22:43220233-43220255 CTGGGCTGCCTCTTCTATCCTGG + Intronic
1184277395 22:43417864-43417886 CTTGGCTCCGTCTCCTCTTGGGG - Intronic
1184672850 22:46024570-46024592 CAAGGCTTCCTCTCCTCTCCTGG + Intergenic
1184729213 22:46363866-46363888 CTGGGCTTCCTCTGCACTCAGGG + Intronic
1185080285 22:48705978-48706000 CTTGGCTTCCTCCTCTCTCCTGG - Intronic
1185215840 22:49599590-49599612 CGGGGTTCCCACACCTCTCCTGG - Intronic
1185266360 22:49906346-49906368 TTTGGCTCCCTCTCGTCTCAGGG - Intronic
1185295859 22:50054417-50054439 CTGGGCTCCCTCTCCTGGGGAGG + Intronic
1185414763 22:50703990-50704012 CTGGCCTCCCTCTACACTGCAGG - Intergenic
949903843 3:8842110-8842132 CTCAGCTCCCTCTTTTCTCCTGG - Intronic
950451644 3:13068737-13068759 CGGGGCCCCCACTCTTCTCCTGG + Intronic
950499939 3:13357415-13357437 CTGGTCTCCCTGTCATCTCTGGG + Intronic
950613675 3:14141904-14141926 CTGCACTCCCTCTCCTCTTCAGG + Exonic
950952595 3:17016455-17016477 CTGGCCTCCCTCCTCTCTGCAGG - Intronic
951140036 3:19148210-19148232 TTGCGCTCGCTCTCCTTTCCCGG + Intergenic
951510153 3:23491541-23491563 CTGGGCTCTTTCTTGTCTCCTGG - Intronic
952045388 3:29312868-29312890 CTCTGCTCACTCTCTTCTCCTGG + Intronic
952207430 3:31193957-31193979 ACAGGCTCCCTCTCCCCTCCAGG + Intergenic
952446899 3:33389895-33389917 CTGTCCCCCATCTCCTCTCCAGG + Exonic
952921239 3:38285248-38285270 CAGGGCCCCCTCCCCTCTGCTGG - Intronic
953044121 3:39280368-39280390 CTGGGCTCCCTCTCGTGGGCAGG - Intronic
953901050 3:46844621-46844643 CTGGTCTCCCTCTCTGCTACTGG + Intergenic
954159633 3:48711552-48711574 CTGGGCTCTCTCTCCTTTAGAGG + Intronic
954329937 3:49884490-49884512 CTGGGCTGCCTCTCCTCTAGGGG - Intergenic
954538421 3:51378350-51378372 CTGGGCCCCCTCAGCTGTCCAGG - Intronic
954705847 3:52480137-52480159 CTGTGCTTCCTCTTCTCTCCCGG + Intronic
954751164 3:52814442-52814464 CTGGGCTTCCCCTCTTGTCCAGG + Intronic
955326188 3:58010516-58010538 CTGGGGTCCATCTCCTGTACTGG + Intronic
955393035 3:58535094-58535116 CTGGGCTGCCCATCCTATCCTGG + Exonic
957646593 3:82939044-82939066 CTGGGCTCTCTCCCTGCTCCTGG + Intergenic
960122222 3:113958500-113958522 CTGGGCGCCGGCTCCTCTGCGGG + Exonic
960131986 3:114066730-114066752 CTGGGCTCCCACTCCTAACCTGG - Intronic
960758827 3:121049751-121049773 CCAGGCTCCCTCACGTCTCCAGG - Intronic
961165834 3:124763298-124763320 CTGGGCTGTCTCTCCCTTCCAGG - Exonic
961495549 3:127288499-127288521 CTGGTCTCCCCCTCCATTCCCGG - Intergenic
961814830 3:129544109-129544131 CTGGGCTGCCTCTCTCCTCCCGG - Intronic
962251423 3:133838333-133838355 GTGGGCTCCCTCTGCCCTGCTGG - Intronic
962362642 3:134754963-134754985 CTGGGCTCCCTCTTCACTGCAGG + Intronic
962575610 3:136752456-136752478 CTCAGCTCCCTCCCCTTTCCGGG - Intergenic
963051065 3:141144404-141144426 CTGTGCTTCCTTTCCTATCCAGG + Intronic
964544992 3:157824418-157824440 CTGGGCTAAACCTCCTCTCCTGG + Intergenic
964548331 3:157859489-157859511 ATGGGCTCACTCTGCTCCCCAGG - Intergenic
967613271 3:191533698-191533720 CTGGACTCCATGTTCTCTCCAGG - Intergenic
968080111 3:195839959-195839981 CTGGGCCCCAGCTCCTCCCCAGG - Intergenic
968134072 3:196209101-196209123 GAGGGCTGCCTCTCCTCCCCTGG + Intronic
968230452 3:197002480-197002502 GTGAGCTCCGTCTCCTCACCCGG - Exonic
968462138 4:731478-731500 CAGGGCTATCTCTCCCCTCCCGG + Intronic
968462223 4:731694-731716 CGGGGCTCCCCCTCCCCTCGTGG + Intronic
968462304 4:731891-731913 CGGGGCTCCCCCTCCCCTCGTGG + Intronic
968462325 4:731941-731963 CGGGGCTCCCCCTCCCCTCGTGG + Intronic
968485636 4:859704-859726 CCAGGCCCCCTCTTCTCTCCTGG - Exonic
968945634 4:3662129-3662151 CTGGCCGCACTCTCCCCTCCCGG - Intergenic
968963757 4:3759091-3759113 CTGGCCCTCCTCTCCTCTCCTGG + Intergenic
969086347 4:4659462-4659484 CTGAGCTCCCCCATCTCTCCAGG - Intergenic
969298093 4:6281295-6281317 CTGGGCTCCCTCTCTGCCCAGGG - Intronic
969515006 4:7642227-7642249 CTGGGCTACCTCTTTGCTCCTGG + Intronic
969648873 4:8451194-8451216 CTGGGCTCCCTCCCACATCCTGG + Intronic
970200151 4:13596217-13596239 ATGGGCTCCCACTCCCTTCCAGG + Intronic
970623852 4:17855753-17855775 CTGGGCTCCCTCATATGTCCTGG - Intronic
971869258 4:32215329-32215351 CTGGGCTCCTTCTGCTCACGTGG + Intergenic
976012977 4:80514684-80514706 CTGTTCTCCCTCTTTTCTCCTGG + Intronic
976351890 4:84069371-84069393 TTGGGCATGCTCTCCTCTCCTGG + Intergenic
977257717 4:94758503-94758525 CCGGGCTCCCTCCCATTTCCCGG - Intronic
977809138 4:101338564-101338586 CTTGTCTGCCTCTCCTCCCCAGG - Intronic
979032216 4:115664546-115664568 CTTTGCTCCCTCTACTCTCGGGG - Intergenic
980275675 4:130646953-130646975 CTTTGCTCCCTCTCCTACCCTGG + Intergenic
980905424 4:138944048-138944070 CTGGGATGCCTTTCCTGTCCTGG - Intergenic
981143944 4:141303480-141303502 CTGGGCTTCCCCTCCTCATCTGG + Intergenic
983723395 4:170887377-170887399 CTGGTATCCCTCTTCTCTCAGGG + Intergenic
984811108 4:183797382-183797404 CTCGGCACCCTCGCCTCCCCGGG - Intergenic
985647175 5:1090425-1090447 CCCGTCACCCTCTCCTCTCCAGG - Intronic
986169457 5:5303813-5303835 CGGGACTGCCTCTTCTCTCCTGG + Intronic
986721117 5:10562682-10562704 CTGGCCTCCTTCTCTACTCCGGG - Intergenic
986913848 5:12590603-12590625 CTCGGCTTCCACTCCTCCCCTGG - Intergenic
987027203 5:13939582-13939604 CAGGGCCCCGTCTCCTTTCCCGG + Intronic
987340378 5:16935004-16935026 CTTGGCTCCCTTTCCTTTCTTGG - Intronic
988982325 5:36584121-36584143 ATGGATTCCCTCTTCTCTCCTGG + Intergenic
989184061 5:38605821-38605843 CTGGAATCCCTCTCCTCGCTTGG + Intronic
989565703 5:42899028-42899050 CTGGGGTTCCTCTCCTTTCCGGG + Intergenic
989567512 5:42915851-42915873 CTGGGGTTCCTCTCCTTTCCGGG - Intergenic
989573899 5:42971406-42971428 CTGGGGTTCCTCTCGTTTCCGGG - Intergenic
991925675 5:71703034-71703056 CTGGGTTCCCTCCCCTCTCCAGG - Intergenic
991996072 5:72388527-72388549 CTGGGCTCCCAGACCTCTCGGGG + Intergenic
992641774 5:78773951-78773973 CTGTGCTCACTCTCCTCCACGGG - Intergenic
994216041 5:97138722-97138744 ATGGGCTCCCTCTATGCTCCTGG + Intronic
994247025 5:97489482-97489504 CCGGGATCCCTGTACTCTCCAGG - Intergenic
994932557 5:106207713-106207735 CTCGGCTCCCACTGCTCTGCTGG + Intergenic
996543008 5:124649087-124649109 CCCGGCCCCCTCTCATCTCCAGG + Exonic
996774085 5:127115995-127116017 CTTGCCCCCATCTCCTCTCCTGG + Intergenic
997207096 5:132056459-132056481 TTGGGCTGGCTCTCCTGTCCGGG + Intergenic
997350096 5:133224904-133224926 CTGGGCTCTGTCTGCTGTCCAGG + Intronic
997618930 5:135272402-135272424 CTGGGCTCTCCCTCTTCTCAGGG + Intronic
997759070 5:136427504-136427526 CTGGGCTCTCTCTTCACCCCAGG + Intergenic
998038418 5:138935722-138935744 GGGGGCTCCTTCTCCTTTCCTGG + Intergenic
998104098 5:139457357-139457379 CTGGGCTCCCACACTTCTGCTGG + Intronic
998106381 5:139471741-139471763 CTGGGCACCCCCTCTCCTCCAGG + Intergenic
998160141 5:139808635-139808657 CTGGGGTTCCCCTCCACTCCCGG - Intronic
998772687 5:145564482-145564504 GCTGGCTCCCTCTCATCTCCAGG + Intronic
999247049 5:150160615-150160637 CTGGCCTCCCTCTCAGCCCCAGG + Intergenic
999270121 5:150291895-150291917 CCACCCTCCCTCTCCTCTCCTGG - Intergenic
999623072 5:153491524-153491546 GTAGGCTCCCTCTCCTGTTCTGG + Intronic
999868532 5:155727897-155727919 TTGAGCCCCCTCTCCACTCCCGG - Intergenic
999964855 5:156798388-156798410 CTGTGCCCCCTCCCCTTTCCAGG - Intergenic
1000050757 5:157561267-157561289 CTGTGTTCCCCCTCCTCTCCTGG + Intronic
1001501190 5:172236083-172236105 CTGGGCTATCTCTACTCTCCAGG + Intronic
1001570663 5:172728503-172728525 CTGGCCTCCCTCTCACCTGCAGG - Intergenic
1001583691 5:172818300-172818322 CTGGCATCCCCCTCCTCCCCTGG - Intergenic
1001598071 5:172911036-172911058 CTGGGCGCCCTCTCCTGGACTGG + Intronic
1001893466 5:175359110-175359132 TTGGGCTCACTGTCCTCTCTGGG - Intergenic
1001944818 5:175770338-175770360 CTGGGCCTCTTCTCCTCTCCAGG - Intergenic
1002165065 5:177338806-177338828 CTGGCCTCCCCCACCTCACCTGG - Intronic
1002435318 5:179227781-179227803 CTCGGCCATCTCTCCTCTCCTGG - Intronic
1002525305 5:179812329-179812351 CTGGGGTTCCTCTCCTTTTCGGG + Intronic
1002533848 5:179865345-179865367 CTGGTCCCCTTCTCCTCTGCAGG + Exonic
1002580551 5:180207632-180207654 CTGCCCTCCCTCTCCTGCCCCGG + Intronic
1002899567 6:1399554-1399576 CAGGGCTGCCTCTCAGCTCCAGG - Intergenic
1002978644 6:2111943-2111965 CTGTGTTCCCTCACCTCTCCAGG - Intronic
1003851147 6:10223868-10223890 CTGCTTTCCCGCTCCTCTCCGGG - Intergenic
1004206080 6:13592686-13592708 CTGGGCTCCTTCCTCTGTCCTGG + Intronic
1004286865 6:14329325-14329347 CTGCTTTCGCTCTCCTCTCCAGG + Intergenic
1005990284 6:30897998-30898020 GTGGGCTCTCTCTCCTCTCCTGG + Intronic
1006359667 6:33580102-33580124 CTGGGCTCCCACTCAGCCCCTGG - Exonic
1006579282 6:35067295-35067317 ATGTGCTCCCCCTCCTCTCTGGG + Intronic
1006806289 6:36791822-36791844 GTGAGCTCCTTCTCCTCTCCGGG + Intronic
1007019277 6:38503306-38503328 CTGCCCTCCCCCTTCTCTCCAGG + Intronic
1007412667 6:41673958-41673980 CTGGGGGCCCTCCCTTCTCCTGG - Intergenic
1007638418 6:43315586-43315608 TTGGGCCCCCTCTACCCTCCAGG - Intronic
1008639248 6:53444508-53444530 CTGGGTTCCACCTCCTCTTCTGG - Intergenic
1013343503 6:109237690-109237712 CTTGACTCACTCTCTTCTCCGGG - Intergenic
1013369600 6:109457199-109457221 CTGAATTCCCTCGCCTCTCCTGG - Intergenic
1013443017 6:110190742-110190764 CTGGGCTCCCACCCCTTCCCAGG - Intronic
1014725052 6:124962929-124962951 CTGGGCTCCAGCTCTTCGCCGGG - Exonic
1014831703 6:126110297-126110319 CTGGGCTCCATATCCTTCCCAGG + Intergenic
1015550587 6:134408475-134408497 CTGGTCTCCTTCTCTTCTCATGG + Intergenic
1017978404 6:159377261-159377283 CAGGGTACCCTTTCCTCTCCAGG - Intergenic
1018373175 6:163186983-163187005 ACGGGCTCTGTCTCCTCTCCAGG + Intronic
1018447523 6:163871075-163871097 CTTGGCTCCATTTCCTCTCTGGG - Intergenic
1018852527 6:167651324-167651346 CTGGGATCCCTCTCCTGCCCAGG - Intergenic
1019034248 6:169041365-169041387 CCGGGCTCCCTCTCAGCTTCTGG + Intergenic
1019145840 6:169975200-169975222 CTGGGCTCCTTCTGCCCTTCAGG - Intergenic
1019340561 7:507041-507063 CTGGGGCCCATCTCCTCGCCAGG + Intronic
1019355411 7:576264-576286 CTGGGGTCACTCCCCTCTCGGGG + Intronic
1020143887 7:5627981-5628003 CTGGGCTCGCGCTCCTATGCAGG - Intronic
1024453641 7:49578810-49578832 TTGTGATCTCTCTCCTCTCCTGG + Intergenic
1024473531 7:49787836-49787858 CTGGGCTCCCAGTCCTCTCCAGG + Intronic
1026837270 7:73647415-73647437 CTGGGCCCCCTCTCAGCTCCTGG + Intergenic
1026904666 7:74056249-74056271 CTTGGCTCCCTTCCCTCTGCAGG + Exonic
1026919607 7:74145463-74145485 CTGTGCTCCCTCTCCTGTGAGGG + Intergenic
1028650426 7:93144718-93144740 CTGGGCTCACTCACCTCACTGGG + Exonic
1029261259 7:99304383-99304405 CTTGGCTCCCCCTCCCCTCTCGG + Intergenic
1029371496 7:100153816-100153838 CTGTGCTCCCTTCCCTCTCCTGG + Intronic
1029479761 7:100805367-100805389 CTGGGTTCCACCTCCTCCCCCGG - Intronic
1029705359 7:102273095-102273117 CTGAGCTCCTTCTCCTACCCAGG + Intronic
1030349608 7:108469128-108469150 CTGGGCTCTCTCTACCCTCTAGG + Intergenic
1030600287 7:111584339-111584361 CTTGTCTCCCTCTCCTCCTCTGG - Intergenic
1031038042 7:116809273-116809295 TTGGGCTCTCTCTACACTCCTGG - Intergenic
1031359853 7:120836329-120836351 TTGGGGTGCCTCTCCTCTCATGG - Intronic
1032160052 7:129502889-129502911 CTCGGCGCCCGCGCCTCTCCGGG - Intronic
1033344895 7:140519027-140519049 CTGGGCACTTTCTCCTCCCCTGG - Intronic
1033365613 7:140671022-140671044 CTGGCCTTCCCTTCCTCTCCAGG + Intronic
1034330404 7:150277727-150277749 CTGGAGCCTCTCTCCTCTCCCGG + Intronic
1034667639 7:152832121-152832143 CTGGAGCCTCTCTCCTCTCCCGG - Intronic
1035033782 7:155882135-155882157 ATGGGCTCCCTCCAGTCTCCTGG + Intergenic
1035104394 7:156429863-156429885 TTGGTCTCCCTCTCATGTCCTGG - Intergenic
1035204678 7:157287475-157287497 CTGGCCTCCATGTCCTCTTCTGG + Intergenic
1035353947 7:158265960-158265982 CAGGGCTCCTTCGCCTCCCCAGG + Intronic
1035464861 7:159068218-159068240 CTGGGCTGACTCTCCCCTCACGG - Intronic
1035750462 8:1992416-1992438 CCGAGCTCGCTCCCCTCTCCTGG - Intronic
1035761736 8:2073542-2073564 CAGGGCTGCCTCCCCTCCCCGGG - Intronic
1035840718 8:2809824-2809846 CTTGGCTCCCTCCCCACTTCTGG + Intergenic
1036401037 8:8408527-8408549 TTGTCCTGCCTCTCCTCTCCTGG - Intergenic
1037505309 8:19523755-19523777 CTGAGATCCCTGTCCTCACCAGG + Intronic
1037758963 8:21729392-21729414 CAGGGCTGCCCCTCCCCTCCAGG + Intronic
1037892425 8:22630337-22630359 GTGGGCTCCCTCTGCTCTCAGGG - Intronic
1038168348 8:25106329-25106351 CTGGTGGCCCTGTCCTCTCCTGG + Intergenic
1040385496 8:46912576-46912598 CTGAGCACCTTCTCATCTCCTGG + Intergenic
1040531494 8:48269974-48269996 CCTGGCTTCCTCTCCTCACCAGG - Intergenic
1041839893 8:62256680-62256702 CTGGACTCCCTCTCCAGACCAGG - Intronic
1041870469 8:62628219-62628241 GTGGGCCCGCTTTCCTCTCCAGG - Intronic
1042076482 8:65000906-65000928 CGGAGCTTCCTCTCCTCTCCAGG - Intergenic
1042789624 8:72589092-72589114 CTGAGCTCCCTGTCCTTTCTAGG - Intronic
1044604905 8:94039932-94039954 CCGCGGGCCCTCTCCTCTCCTGG - Intergenic
1045388076 8:101690101-101690123 CTGGGCTCCCACTCCGACCCCGG + Intronic
1047423935 8:124728689-124728711 CAGCGCACCCTCTCCTCCCCCGG + Intergenic
1047513028 8:125529812-125529834 GTGGGCACCCTCTCCCCACCTGG - Intergenic
1047757134 8:127927304-127927326 CTGGGCTCCCTCACCACGCAGGG + Intergenic
1048009362 8:130443622-130443644 CTCGGCTCCCGCGCCTCGCCTGG - Exonic
1048544581 8:135374582-135374604 CTGGGCTCGCTCCCCTCACCAGG + Intergenic
1048845451 8:138600588-138600610 CTTAGCCCCATCTCCTCTCCAGG - Intronic
1049236212 8:141513647-141513669 CAGGGGCCCCTCCCCTCTCCTGG - Intergenic
1049273365 8:141707749-141707771 CTGGGCTCACTCCCCACCCCAGG - Intergenic
1049388842 8:142357909-142357931 CTGGCCGCCCCCTCCTCTCATGG - Intronic
1049441949 8:142613655-142613677 CTGGGCTGCCCGTCCTCGCCGGG + Exonic
1049488606 8:142879270-142879292 CTGTCCACCCTCCCCTCTCCTGG + Intronic
1051265733 9:15307009-15307031 CCGGGCTCACTCTTCTCTCCCGG + Intronic
1051610019 9:18952176-18952198 CTGGGGTCCCTCTCATCATCAGG + Intronic
1051740699 9:20248972-20248994 CTGGGCTCCCTGGCCTGTGCAGG - Intergenic
1052409182 9:28101190-28101212 ATGGTCTCCCTCTCCACTGCTGG + Intronic
1052847110 9:33346536-33346558 CTGGGCTCCCTCACACTTCCTGG - Intronic
1053399122 9:37801473-37801495 CTGGGCTCGCTCCCCGCGCCCGG + Intronic
1053438168 9:38091445-38091467 CTGGGCTGCCTCTCATGTTCAGG - Intergenic
1056191647 9:84190120-84190142 CTGGCCTCTCTCTCCTGTTCTGG + Intergenic
1056215298 9:84400691-84400713 CTTGGCTCCCTCTCAGCTGCTGG - Intergenic
1057140349 9:92722944-92722966 CTGGGCTCCCTCTCCTCTCCAGG - Intronic
1057721486 9:97535428-97535450 CTGCACTCCCTCTCTTCACCTGG + Intronic
1058069364 9:100586037-100586059 TTAGCCTCTCTCTCCTCTCCGGG - Exonic
1058800494 9:108540601-108540623 CTGGGCACCCTCTATTCTTCTGG + Intergenic
1059544576 9:115163602-115163624 CTGGGCTCCTGCTACTCTCAGGG - Intronic
1059812471 9:117870874-117870896 CTGTGCTCAGTCTCCCCTCCAGG + Intergenic
1060594796 9:124841469-124841491 CTGGGCCCCCTGACCTCTGCAGG - Intergenic
1061221356 9:129253936-129253958 CTGGGCGGCCCCTCCCCTCCCGG + Intergenic
1061770858 9:132920205-132920227 CTGGTCCTCCTCTCATCTCCTGG + Intronic
1062056894 9:134473503-134473525 GTGGGCTCCCTCACCTGGCCTGG + Intergenic
1062115451 9:134805865-134805887 CGGGGCACCCTCTCTCCTCCAGG - Intronic
1062282922 9:135759965-135759987 CTGGCCTCACTGTCCCCTCCTGG - Intronic
1062451831 9:136618976-136618998 CAGGCCTCCGCCTCCTCTCCTGG - Intergenic
1062540820 9:137040924-137040946 CTGGGCCTCCCCTCCACTCCAGG - Exonic
1062579575 9:137223334-137223356 CTGGGCTCCCGGCCCTCCCCAGG - Intergenic
1185612171 X:1399180-1399202 CTGGGCTCCGTGGCATCTCCTGG + Intergenic
1187002975 X:15201052-15201074 CTGGGCTCCCTTCCCTCAACGGG - Intergenic
1187503519 X:19859770-19859792 TTGGGCTCCCTGTCCCCTCCTGG + Intronic
1187807055 X:23132180-23132202 CTGAGCTCCCTCTGCTTCCCTGG - Intergenic
1188006145 X:25016850-25016872 CAGGGATCCCTGACCTCTCCAGG + Intergenic
1188307170 X:28572397-28572419 CCTGGCCCCCTCTCCTCTCCAGG - Intergenic
1189516770 X:41720335-41720357 CTGAGCCCCCTGCCCTCTCCAGG - Intronic
1189740489 X:44112692-44112714 CTGAGCTCCCTTTCATCTCAAGG + Intergenic
1192185957 X:68946979-68947001 CAGGCCTCCCTCACCTCTTCTGG + Intergenic
1197251060 X:124216923-124216945 CTGGGAACTCTTTCCTCTCCTGG + Intronic
1197284583 X:124581279-124581301 ATGGTCTCCATCTCCTCACCTGG + Intronic
1198442160 X:136673666-136673688 CTGCCCTCACTTTCCTCTCCTGG + Intronic
1199609406 X:149600168-149600190 CTGTGTTCTCTCCCCTCTCCTGG + Intronic
1199629711 X:149769186-149769208 CTGTGTTCTCTCCCCTCTCCTGG - Intergenic
1199738760 X:150711649-150711671 CTGGGCTTTCCCTCCTCTCCGGG + Intronic
1199875157 X:151922747-151922769 CTGAGGTCCCTCTCTTATCCTGG + Intronic
1200001710 X:153065495-153065517 CTCGTGTCCCTGTCCTCTCCTGG - Intergenic
1200171997 X:154083772-154083794 TGGGGCTCCCACTCCACTCCAGG - Intronic