ID: 1057142304

View in Genome Browser
Species Human (GRCh38)
Location 9:92734895-92734917
Sequence CAGCTGCTCTGGGGAACAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057142292_1057142304 7 Left 1057142292 9:92734865-92734887 CCTCCATCCCACCCGTGCCCACA 0: 1
1: 2
2: 5
3: 70
4: 619
Right 1057142304 9:92734895-92734917 CAGCTGCTCTGGGGAACAAAAGG No data
1057142297_1057142304 -5 Left 1057142297 9:92734877-92734899 CCGTGCCCACAACTTCTCCAGCT 0: 1
1: 0
2: 3
3: 33
4: 389
Right 1057142304 9:92734895-92734917 CAGCTGCTCTGGGGAACAAAAGG No data
1057142298_1057142304 -10 Left 1057142298 9:92734882-92734904 CCCACAACTTCTCCAGCTGCTCT 0: 1
1: 0
2: 1
3: 35
4: 372
Right 1057142304 9:92734895-92734917 CAGCTGCTCTGGGGAACAAAAGG No data
1057142293_1057142304 4 Left 1057142293 9:92734868-92734890 CCATCCCACCCGTGCCCACAACT 0: 1
1: 0
2: 1
3: 36
4: 425
Right 1057142304 9:92734895-92734917 CAGCTGCTCTGGGGAACAAAAGG No data
1057142291_1057142304 8 Left 1057142291 9:92734864-92734886 CCCTCCATCCCACCCGTGCCCAC 0: 1
1: 1
2: 3
3: 31
4: 474
Right 1057142304 9:92734895-92734917 CAGCTGCTCTGGGGAACAAAAGG No data
1057142295_1057142304 -1 Left 1057142295 9:92734873-92734895 CCACCCGTGCCCACAACTTCTCC 0: 1
1: 1
2: 0
3: 17
4: 271
Right 1057142304 9:92734895-92734917 CAGCTGCTCTGGGGAACAAAAGG No data
1057142296_1057142304 -4 Left 1057142296 9:92734876-92734898 CCCGTGCCCACAACTTCTCCAGC 0: 1
1: 0
2: 1
3: 25
4: 324
Right 1057142304 9:92734895-92734917 CAGCTGCTCTGGGGAACAAAAGG No data
1057142290_1057142304 17 Left 1057142290 9:92734855-92734877 CCAGATGTGCCCTCCATCCCACC 0: 1
1: 0
2: 1
3: 23
4: 292
Right 1057142304 9:92734895-92734917 CAGCTGCTCTGGGGAACAAAAGG No data
1057142289_1057142304 18 Left 1057142289 9:92734854-92734876 CCCAGATGTGCCCTCCATCCCAC 0: 1
1: 0
2: 1
3: 17
4: 200
Right 1057142304 9:92734895-92734917 CAGCTGCTCTGGGGAACAAAAGG No data
1057142294_1057142304 0 Left 1057142294 9:92734872-92734894 CCCACCCGTGCCCACAACTTCTC 0: 1
1: 0
2: 0
3: 10
4: 172
Right 1057142304 9:92734895-92734917 CAGCTGCTCTGGGGAACAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057142304 Original CRISPR CAGCTGCTCTGGGGAACAAA AGG Intronic
No off target data available for this crispr