ID: 1057143901

View in Genome Browser
Species Human (GRCh38)
Location 9:92745778-92745800
Sequence TTTCTCTTCAGACCCTCTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 235}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057143901_1057143905 9 Left 1057143901 9:92745778-92745800 CCCCAAGAGGGTCTGAAGAGAAA 0: 1
1: 0
2: 0
3: 15
4: 235
Right 1057143905 9:92745810-92745832 AGAGGCTGATGATCCAGAAGTGG No data
1057143901_1057143906 13 Left 1057143901 9:92745778-92745800 CCCCAAGAGGGTCTGAAGAGAAA 0: 1
1: 0
2: 0
3: 15
4: 235
Right 1057143906 9:92745814-92745836 GCTGATGATCCAGAAGTGGCTGG No data
1057143901_1057143908 19 Left 1057143901 9:92745778-92745800 CCCCAAGAGGGTCTGAAGAGAAA 0: 1
1: 0
2: 0
3: 15
4: 235
Right 1057143908 9:92745820-92745842 GATCCAGAAGTGGCTGGGCCTGG No data
1057143901_1057143904 -9 Left 1057143901 9:92745778-92745800 CCCCAAGAGGGTCTGAAGAGAAA 0: 1
1: 0
2: 0
3: 15
4: 235
Right 1057143904 9:92745792-92745814 GAAGAGAAAGCAAGAAAGAGAGG No data
1057143901_1057143909 20 Left 1057143901 9:92745778-92745800 CCCCAAGAGGGTCTGAAGAGAAA 0: 1
1: 0
2: 0
3: 15
4: 235
Right 1057143909 9:92745821-92745843 ATCCAGAAGTGGCTGGGCCTGGG No data
1057143901_1057143907 14 Left 1057143901 9:92745778-92745800 CCCCAAGAGGGTCTGAAGAGAAA 0: 1
1: 0
2: 0
3: 15
4: 235
Right 1057143907 9:92745815-92745837 CTGATGATCCAGAAGTGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057143901 Original CRISPR TTTCTCTTCAGACCCTCTTG GGG (reversed) Intronic
900193548 1:1361920-1361942 TATATCTTGAGACCCCCTTGGGG - Intergenic
900738172 1:4313240-4313262 TTTCTCTTAACACCATTTTGTGG + Intergenic
902675300 1:18004626-18004648 TGCCTTTTCAGACCTTCTTGTGG - Intergenic
903671225 1:25036733-25036755 CTTCACATCAGACCCCCTTGGGG + Intergenic
905211047 1:36374381-36374403 TTTCTCTGCAGGCTCTCCTGGGG + Intronic
905545162 1:38791995-38792017 TTGCTCTTCACAACCTCTTAGGG + Intergenic
906002501 1:42438803-42438825 TCTCTCTTCAGCCTCTCTTCTGG - Intronic
907348748 1:53807517-53807539 TCTCTCTTCTGAGACTCTTGGGG - Intronic
907917105 1:58881464-58881486 TTGCTCTTTAGACGCTCTTGTGG + Intergenic
908276367 1:62476433-62476455 TTTCTCTTGAGGACTTCTTGTGG - Intronic
909021189 1:70433138-70433160 TTTCTTTTTAGATCCTTTTGAGG + Intronic
909989773 1:82209580-82209602 TTTCTCTTCAACCTCTCTTTGGG - Intergenic
911262123 1:95699234-95699256 TTTTTCTTCAGGGCCTGTTGAGG + Intergenic
911798692 1:102107220-102107242 ACTCTCTTCAGAGTCTCTTGAGG + Intergenic
912995928 1:114532414-114532436 TTCCTCCTCAGACCCACTTCAGG + Intergenic
913070947 1:115298073-115298095 TATATTTTCAGACCTTCTTGTGG - Intronic
913273890 1:117119794-117119816 TTTCTCTGCAGCCACTCTTCTGG - Intronic
913879035 1:124105334-124105356 TGGATATTCAGACCCTCTTGAGG + Intergenic
915075515 1:153305476-153305498 TTTTTCTTCAGATTCTCTTTAGG + Intronic
915883546 1:159699781-159699803 TCTTTCTTCAGAGCCTCATGTGG - Intergenic
918339165 1:183553008-183553030 TTCCTCTTCAGACTGTCTTTTGG - Exonic
918482528 1:184994106-184994128 TTTCTCTTCAGAAACTTTGGAGG - Intergenic
919136606 1:193516979-193517001 TTTGTCTTCTGATTCTCTTGTGG + Intergenic
922440933 1:225654010-225654032 TTTCTCTTCTTCCACTCTTGCGG - Intergenic
923992997 1:239460114-239460136 TTCCTCTTCAGAACCTGTTCTGG - Intronic
1063735344 10:8747391-8747413 TTTCACTTCTGAGCATCTTGAGG - Intergenic
1064156201 10:12905405-12905427 TTTGCCTTGAGCCCCTCTTGAGG - Intronic
1064252642 10:13718486-13718508 TCTCTCTACGGATCCTCTTGCGG + Intronic
1064714651 10:18164216-18164238 TTTATCTTAAGTCCCTGTTGTGG + Intronic
1067018544 10:42775530-42775552 TTTCTCTTCAGCCCATTATGAGG - Intergenic
1067555818 10:47269486-47269508 TCTCTATTGAGGCCCTCTTGTGG + Intergenic
1070793849 10:79205478-79205500 TTTCTCTTTTGAGCCTCCTGAGG - Intronic
1071057287 10:81526751-81526773 TTTCTTTTGAGACCCCTTTGTGG - Intergenic
1072337921 10:94416357-94416379 TTTCTCAACAGAGCCTATTGAGG + Intronic
1074320908 10:112401291-112401313 TTTATCTTGAGACTCACTTGGGG + Intronic
1075243670 10:120801068-120801090 TTTCTATTCAGACCCTCAAAAGG - Intergenic
1075420400 10:122296225-122296247 TTACTCTACAGACATTCTTGAGG - Intronic
1075686212 10:124367031-124367053 TTTCTGCTCAGACCTTCCTGTGG + Intergenic
1075787178 10:125057926-125057948 CTTCCCGTGAGACCCTCTTGGGG - Intronic
1077817094 11:5696494-5696516 TCTCTCTTCTGCCCCTCCTGTGG - Exonic
1079553280 11:21727763-21727785 TTTCTATTCAGAGTCTTTTGTGG + Intergenic
1079676237 11:23230436-23230458 TTTCTCTTCAAACCATCATGGGG - Intergenic
1079751155 11:24199603-24199625 TTTTCCTTCAGACACTGTTGTGG + Intergenic
1080161129 11:29177746-29177768 TTTGTCTTAAAACACTCTTGGGG + Intergenic
1080213807 11:29817982-29818004 TTTCTCTTCAGTGCCTCTTTCGG + Intergenic
1080844744 11:36016810-36016832 TTTCCCTTCTGACTCTATTGTGG + Intronic
1081277167 11:41164374-41164396 CTTCTCTTCAGTACCTCCTGAGG + Intronic
1082898015 11:58213735-58213757 TGTCTCTTGAGACCATTTTGGGG + Intergenic
1084507340 11:69576386-69576408 TCTCTCTCCAGTTCCTCTTGGGG - Intergenic
1086236290 11:84635081-84635103 TTTCTCTGAAGAACTTCTTGAGG - Intronic
1088297027 11:108310149-108310171 TTTTTCTTTAGACCTTCTTCAGG + Exonic
1088554080 11:111043908-111043930 TTACTCTTCAGACCTTCTTCTGG + Intergenic
1090601157 11:128373032-128373054 TGTGTCTTCAGACCCTGCTGGGG + Intergenic
1092590705 12:9951479-9951501 TTCCAGTTCAGACACTCTTGGGG + Intronic
1094076675 12:26483887-26483909 TTTGCCTTCAGAACTTCTTGAGG - Exonic
1096136131 12:49203165-49203187 TATCTCTTCAGATACTCTTTTGG - Intronic
1096689327 12:53309710-53309732 TTCCCCTCCAGACCCTCTTCTGG - Exonic
1098980654 12:76952207-76952229 TTTCTCCTTAGCCCCTATTGCGG + Intergenic
1100444029 12:94644416-94644438 TTTTGCTTCAGACCCTCTGCCGG - Intronic
1102150496 12:110686529-110686551 TTTCCCTTCACCTCCTCTTGTGG - Intronic
1102548646 12:113674871-113674893 TCTCTCTCCAGACCCTCCTCTGG + Intergenic
1104643576 12:130482195-130482217 AGTCTCTGCAGACCCTCATGAGG + Intronic
1104884430 12:132097852-132097874 TTTCTGTTAAAAGCCTCTTGGGG + Intronic
1104932731 12:132348305-132348327 TTCCTCTTCAGTCCTTCTCGTGG - Intergenic
1105271208 13:18876308-18876330 ATTCTCTTCACAACCTCGTGGGG + Intergenic
1110731647 13:78885413-78885435 TTTATCTTCAGACCCTAGTCTGG + Intergenic
1111869735 13:93816063-93816085 TTTCTCTACAGAGCCTTTGGTGG - Intronic
1114886645 14:26859978-26860000 CTTCTCTTCAGCTCTTCTTGTGG - Intergenic
1115935433 14:38547192-38547214 TTTCTTATGAAACCCTCTTGAGG - Intergenic
1117244839 14:53874497-53874519 TTTCTCTGCGGTCCCTCTGGTGG - Intergenic
1118141084 14:63083821-63083843 TTTCTCATCAGAAACTCTGGAGG + Intronic
1119427433 14:74544918-74544940 TTTCTCTTGAGAACCACGTGGGG + Intronic
1119890639 14:78179559-78179581 GTTCCCTTCCGACCCTCCTGGGG - Intergenic
1121880367 14:97494950-97494972 GTTCTCTTAAGACCATCTTCTGG - Intergenic
1123152091 14:106192420-106192442 TTGCTTTTCAGACCCTTTTTTGG + Intergenic
1126431019 15:48584682-48584704 TTTCTTTTCAGACCTTATTTAGG - Intronic
1126710438 15:51449387-51449409 TTTTCCTTCACATCCTCTTGTGG + Intronic
1127109571 15:55653308-55653330 TTTGTCTTAAGACCCTATGGGGG - Intronic
1127640302 15:60909784-60909806 TTTCACTCCAGTCCCACTTGAGG - Intronic
1130179451 15:81610268-81610290 TTTCACTTGACACCCTATTGAGG - Intergenic
1132791300 16:1690184-1690206 CTCGTCTTCAGACCCGCTTGAGG - Intronic
1133982607 16:10644614-10644636 TTTGTCTCCAGACCCTATGGGGG + Intronic
1137248194 16:46722358-46722380 TTTATCCTCACACCCTCTGGGGG - Intronic
1138119714 16:54389937-54389959 TCTCTCTACAGAGCCTCTGGAGG + Intergenic
1140028257 16:71311719-71311741 TTTTTCCCCAGACCCTCCTGTGG + Intergenic
1140646894 16:77040790-77040812 TTTTTCTTCAGACTCTCCTAAGG - Intergenic
1141788702 16:86218469-86218491 CTCCTCTTCTGACTCTCTTGAGG - Intergenic
1142128129 16:88420196-88420218 TTTCTCCTCAGCCCCTCTGTGGG - Intergenic
1143926047 17:10371521-10371543 TTCCTCTTCATACCCCCTTAAGG - Intronic
1144843974 17:18206377-18206399 TTTCTCTCCAGCCCCTCTACAGG + Intronic
1145889112 17:28402553-28402575 TTTCTTGTCTGAACCTCTTGTGG + Exonic
1146910329 17:36644325-36644347 TTGCACTGCAGACCCTCATGCGG + Intergenic
1147564620 17:41528541-41528563 TCTCTCTGCAGACCCTGTTCTGG + Intergenic
1148261435 17:46187108-46187130 TTTCCCTTCACACCCTCTGGTGG + Intronic
1149810804 17:59669288-59669310 TTGCTCTTCATACCATTTTGAGG + Intronic
1151898975 17:76999150-76999172 ATCCTCTTCAGTCCCTCTGGAGG - Intergenic
1152013761 17:77736205-77736227 TCTCTCTCCAGACCCTGTAGGGG + Intergenic
1152019525 17:77773080-77773102 TTGCCCTTCAGGCCCTCTTCTGG + Intergenic
1153832785 18:8937913-8937935 TTTCTTTTCTCACCATCTTGAGG - Intergenic
1156395569 18:36696677-36696699 TTTTCCATCTGACCCTCTTGTGG + Intronic
1157968772 18:52241344-52241366 CCTCTCCTCAGACTCTCTTGAGG + Intergenic
1158171711 18:54607081-54607103 TCTCTCTTCAGCCCCTAGTGCGG - Intergenic
1161414888 19:4140512-4140534 TTTCTCATAAGATCCTCTAGAGG + Intergenic
1161646579 19:5456745-5456767 TGTCTCCTCAGCCCCTCCTGAGG + Exonic
1163091933 19:15026354-15026376 TTTCCCTTCAGACCCACAGGTGG - Intergenic
1165053181 19:33156208-33156230 TATGTCTTCAGGTCCTCTTGGGG + Intronic
1166946848 19:46402567-46402589 CTTCTCTTCAAATCCTCTTATGG + Intergenic
926885471 2:17594488-17594510 TTTCTCATCAGCCCATCTTCTGG - Intronic
927309909 2:21618307-21618329 TGTCTCTTCAAAGCCTCTTTCGG + Intergenic
929390603 2:41464588-41464610 GTCCTCATCTGACCCTCTTGAGG + Intergenic
931158098 2:59658188-59658210 GTTCTCTTTAGACACTCTTATGG - Intergenic
931701331 2:64911496-64911518 ATTCTCTTAAGGCCCTCTTCAGG - Intergenic
933729312 2:85445230-85445252 TTTATCTCCGGATCCTCTTGGGG - Intergenic
934488754 2:94742803-94742825 TTTCTCTTTCCCCCCTCTTGTGG + Intergenic
937082964 2:119153549-119153571 GTTCTCATCTGACCCTCTGGAGG + Intergenic
937422420 2:121769115-121769137 TTTCACTTCCGACCCCCTTGTGG - Intergenic
937673493 2:124563949-124563971 TTGCACTTCAGCCCCTATTGAGG - Intronic
937943698 2:127311444-127311466 TTTCTCCTCCGCCCTTCTTGTGG - Intronic
941883613 2:170506036-170506058 TTTCTCTTCTGATGCTCTTTGGG + Intronic
942039544 2:172044995-172045017 TTTTTCTTCAGATACTCCTGAGG - Intronic
943519230 2:188926793-188926815 TTTCTCTTCATAGTCTCTTGAGG + Intergenic
946394675 2:219437184-219437206 TCTCTCTCCAGAACTTCTTGAGG - Intronic
946458177 2:219846372-219846394 GTTCTATTCAGGCCCTCATGGGG + Intergenic
947455601 2:230250938-230250960 TTTCTCTTCATAATTTCTTGAGG + Intronic
1169400504 20:5275314-5275336 TTTCTCTTAAGTCCTTCATGAGG + Intergenic
1169698661 20:8421477-8421499 TTTCTCTGCAGACCATCTGATGG - Intronic
1170001272 20:11617375-11617397 TTTTTCTTGAGGCCCTCTTAGGG - Intergenic
1170347262 20:15400893-15400915 TTTCTCTTCCCTCCCTCATGGGG - Intronic
1174023056 20:47547333-47547355 TTTCTCTTTAAACCCTGTGGTGG + Intronic
1177999239 21:28140505-28140527 TTTCTCTTCAGAAGATCTAGGGG - Intergenic
1179310279 21:40189470-40189492 TTGCTCTTCCAACCCTGTTGAGG + Intronic
1181575593 22:23792465-23792487 GTGCTCTTCAGACACTCTGGGGG + Intronic
1182679927 22:32070777-32070799 TTTCTCTTCCTACCATCTTTTGG - Intronic
1184925469 22:47633365-47633387 TTTCTCTGCAGACCCACTCACGG - Intergenic
953340297 3:42128536-42128558 TCTCTCTACAGACCCTTTAGGGG - Intronic
953349780 3:42206860-42206882 TTTCTCTTCAGCCCATCCTTGGG + Intronic
953802482 3:46035806-46035828 TTTCACTACGGACACTCTTGGGG + Intergenic
954719720 3:52550961-52550983 TTTCTATTCAAATCCTATTGGGG - Intronic
954891092 3:53929214-53929236 TTTCCTTTCTGACCCTCATGTGG + Intergenic
958078230 3:88711940-88711962 TATCTCTTCAGAGCCTCTTTCGG - Intergenic
958242824 3:91103709-91103731 TTTCTCTTTAGAGCGTTTTGAGG + Intergenic
958266457 3:91443340-91443362 GTTCTCCTCAGAACATCTTGGGG - Intergenic
960058503 3:113294656-113294678 TTTACCTTCAGACCCTTTTTCGG - Intronic
961258206 3:125576200-125576222 TTTACCTCCAGACCATCTTGTGG - Exonic
963901139 3:150734581-150734603 GTTCTCTTCAGTCCCTCCAGGGG + Intergenic
964231408 3:154474197-154474219 TTTCTCTTTAGATTCTCTTAAGG + Intergenic
965762997 3:172099932-172099954 GTACTCCTAAGACCCTCTTGGGG + Intronic
967077118 3:186013585-186013607 TTTCTCTCCAGACTCCCTGGGGG + Intergenic
967879914 3:194294503-194294525 TTTCCCTTCAAACCATCATGAGG + Intergenic
968006752 3:195248247-195248269 TTTCTCCTTAGCCCCTCCTGAGG - Intronic
969842306 4:9891504-9891526 TTCCACTCCAGACACTCTTGTGG - Intronic
969924011 4:10568732-10568754 TTCCTCTTCAGAGCCCCTGGAGG + Intronic
969981901 4:11166077-11166099 TTTCTCTTCACAGCGTCTTGGGG - Intergenic
972363310 4:38349260-38349282 CTTCTCTTTATACCATCTTGAGG + Intergenic
973176044 4:47206145-47206167 TTTTTATTCAGACACTCTGGTGG + Intronic
975914555 4:79308674-79308696 ATTATCTCCTGACCCTCTTGAGG + Intronic
977810202 4:101348054-101348076 TCTCTCTTCTTGCCCTCTTGTGG - Intronic
978358621 4:107904670-107904692 TTTCTGTTCTCACACTCTTGTGG + Intronic
978920732 4:114180120-114180142 TGTCTGTTCAGACCCTTTTCAGG + Intergenic
979056058 4:115996355-115996377 TTTCTGTTCAGACCCATTTTAGG - Intergenic
979661361 4:123259368-123259390 TTCCTCTTGAGAGCCTCCTGAGG - Intronic
980486926 4:133470341-133470363 TTTGTGGGCAGACCCTCTTGTGG + Intergenic
981758512 4:148168026-148168048 TCTCTCTTCAGACTCTCTCAAGG - Intronic
984992396 4:185393956-185393978 TTTCTCTGAAGACTCTTTTGCGG + Intronic
985829898 5:2220594-2220616 TTTTTCTTCAGTCCCTTGTGGGG - Intergenic
986697590 5:10372222-10372244 TTTCTCCTAAGACCCAATTGAGG + Intronic
988788101 5:34582606-34582628 TTTCTCTCCCAAGCCTCTTGAGG - Intergenic
990183966 5:53192765-53192787 TTCTCCTTCAGACCCTCTAGAGG + Intergenic
992015571 5:72572155-72572177 TATGTTTTCAGCCCCTCTTGAGG - Intergenic
993574917 5:89588935-89588957 TTTCTATTCAGAAACTTTTGAGG - Intergenic
994238315 5:97391561-97391583 TCTCTCTTCAGCCCCACTTTGGG - Intergenic
994904860 5:105826587-105826609 TTTCTCTTCCCAGCCTCATGAGG + Intergenic
995383223 5:111559999-111560021 TTTCTCATCAGAAACTCTGGAGG - Intergenic
995422127 5:111979372-111979394 TTTCTCTTCCTACCCTCTCCAGG - Intronic
998173232 5:139884558-139884580 TTTCCCGTCAGACACTCATGGGG + Intronic
998423081 5:142005191-142005213 TTTTTCTTCAGACCCTAGTTAGG - Intronic
999545699 5:152626141-152626163 TATGTCTTCAGGACCTCTTGAGG + Intergenic
1001436975 5:171706917-171706939 GTTCTCTTCAGATCCACATGGGG - Intergenic
1002325702 5:178404188-178404210 TCTCTCTTCAGATCCCCTTGTGG + Intronic
1002600137 5:180349621-180349643 ATTCTCCTCAGAGCCTCTGGAGG + Intronic
1003088792 6:3083615-3083637 TTTCTTTTCAGTCCCTACTGTGG + Intronic
1003974411 6:11329126-11329148 TTTGTCTTAGGGCCCTCTTGAGG - Intronic
1004000339 6:11591770-11591792 TTTCTCTTAAGAGCCTCTCCCGG - Intergenic
1004105567 6:12664556-12664578 TTTCTCTTCAGAGCATATTGTGG - Intergenic
1005669576 6:28091371-28091393 CTTCTCTTCACGCCCTCCTGGGG - Intergenic
1006271427 6:32969501-32969523 TTTCTCCCCAGAGCCTCTGGAGG + Intronic
1006501621 6:34462936-34462958 TGTCTTTTAAGAGCCTCTTGGGG + Intergenic
1007277452 6:40685624-40685646 TGTCTTTTCAAACCCTCCTGGGG + Intergenic
1007806792 6:44456370-44456392 TCTCTGTCCAGGCCCTCTTGGGG + Intergenic
1008547156 6:52593397-52593419 TTTCTCCTGACACCCTCTTTAGG + Intergenic
1008988756 6:57578291-57578313 GTTCTCCTCAGAACATCTTGGGG + Intronic
1009177357 6:60476852-60476874 GTTCTCCTCAGAACATCTTGGGG + Intergenic
1011433868 6:87316696-87316718 TTTCTTCTCAAACCCTTTTGTGG + Intronic
1011937160 6:92794323-92794345 TGTCTCTTCAGCCCCTCATAAGG - Intergenic
1015564196 6:134550224-134550246 CTTCTCTTCAGTCACTTTTGGGG + Intergenic
1016053551 6:139554946-139554968 CCTCTCTTCAGTCTCTCTTGGGG - Intergenic
1018580321 6:165302387-165302409 TTTCTCCATAGACCCTCTTTTGG - Intronic
1018625802 6:165777596-165777618 TGTGGCTTCAAACCCTCTTGGGG + Intronic
1020349797 7:7206805-7206827 TTTCTCATCAGACACTTTGGAGG - Intronic
1023205596 7:37746020-37746042 TGTCTTTCCAGACCCTCCTGAGG - Intronic
1023408459 7:39862371-39862393 TTGCTCTTCAGGCTCTTTTGTGG + Intergenic
1025605749 7:63038810-63038832 TTGTTCTTCAAACCCTCCTGTGG - Intergenic
1026374469 7:69736715-69736737 ATTCTCTGCAGACCCTTCTGTGG + Intronic
1028471309 7:91209501-91209523 TTTCTCTTCTGCCCTCCTTGTGG + Exonic
1030080142 7:105770576-105770598 TTCCTCTGCTGTCCCTCTTGAGG - Intronic
1033629933 7:143147702-143147724 TTCCTATTCAGATCCTATTGTGG + Intergenic
1033656634 7:143379966-143379988 TTTCTCTTCATAAACTTTTGGGG + Intergenic
1035263501 7:157675999-157676021 TGCCTCTTCTGATCCTCTTGGGG + Intronic
1037992504 8:23330903-23330925 GTGCTCTTCAGAGGCTCTTGAGG + Intronic
1039348666 8:36736163-36736185 TTTCTCTTCAGACTCTTCTTTGG + Intergenic
1039390610 8:37178126-37178148 TTTAACTTTAGACCCTGTTGAGG - Intergenic
1039482112 8:37881929-37881951 TTTCTCTTCTGACAGTCATGTGG + Intronic
1039988589 8:42468508-42468530 TTTGTCTTCAGACACCCCTGAGG - Intronic
1041087645 8:54271607-54271629 TTTCTCTTCTGCCCTTCCTGGGG + Intergenic
1042313920 8:67405605-67405627 TTGCTCTGCAGACCCTGCTGAGG + Intergenic
1043249420 8:78052259-78052281 TTTCACTTCAGACCTTTTTTGGG + Intergenic
1045900441 8:107273027-107273049 TCTCTGGTCTGACCCTCTTGTGG + Intronic
1046223006 8:111239785-111239807 TTTCTCTTCAGACCATATTATGG - Intergenic
1046622990 8:116547498-116547520 TTTCCCTTCAGAACCTCTGTGGG - Intergenic
1047763323 8:127970200-127970222 TGTCTCCTCAGACCCTCAGGGGG + Intergenic
1047766496 8:127994221-127994243 TCTCTCTACAGTGCCTCTTGTGG + Intergenic
1050232424 9:3541173-3541195 TTACTCTGGAGACCCTCTTGTGG + Intergenic
1050430916 9:5560658-5560680 CTTCTCTTCAGTTCCTCTTAGGG + Intronic
1051135085 9:13910980-13911002 TTTGACTTCAGAACCTCTTTTGG - Intergenic
1052446322 9:28565907-28565929 TGTCTTCTCAGACACTCTTGGGG + Intronic
1053282300 9:36828555-36828577 TTTCTTTCCAAACCCTCTTCAGG + Intergenic
1053669028 9:40341554-40341576 TTTCTCTTTCCCCCCTCTTGTGG - Intergenic
1053918828 9:42967813-42967835 TTTCTCTTTCCCCCCTCTTGTGG - Intergenic
1054380165 9:64481593-64481615 TTTCTCTTTCCCCCCTCTTGTGG - Intergenic
1054515583 9:66034738-66034760 TTTCTCTTTCCCCCCTCTTGTGG + Intergenic
1057143901 9:92745778-92745800 TTTCTCTTCAGACCCTCTTGGGG - Intronic
1057402756 9:94739249-94739271 GTTGTCTTCAGACCCTTTTGGGG + Intronic
1060061931 9:120468369-120468391 TTGCACTTGAGACCCTCTGGAGG + Intronic
1060998162 9:127886558-127886580 CTTCTCCTCTGACCCTCCTGAGG + Exonic
1061405182 9:130389904-130389926 TTTCTCTTCATTCCCTTCTGTGG + Intronic
1062588776 9:137263641-137263663 CTTCTCTCCAGACCCTGATGGGG + Intronic
1186140658 X:6568416-6568438 TTTCTCATCTGCCCATCTTGTGG + Intergenic
1186211826 X:7257495-7257517 TTCCTCTTCACAGCCTCTTCGGG + Exonic
1187383702 X:18828612-18828634 TTACTCTTAAGGGCCTCTTGAGG + Intergenic
1189683847 X:43543535-43543557 TTCATCTTCATACCATCTTGAGG - Intergenic
1190599841 X:52079356-52079378 TTTATCTTAAGATCCTTTTGTGG + Intergenic
1190845312 X:54185206-54185228 TTTCACTTCTGTCCCTCTGGTGG - Intergenic
1191898213 X:66015640-66015662 ATTCTCTTCAGACCCTCCTCAGG + Intergenic
1192833245 X:74772541-74772563 TTTCTCTCCAGCCCCTCCTTGGG + Intronic
1194799988 X:98261346-98261368 CTTCTCATCTGTCCCTCTTGTGG - Intergenic
1198425178 X:136511214-136511236 ATCCTCTTCAGATCCTCTTACGG - Exonic
1198869842 X:141165868-141165890 TTTCTCCTCAAAGTCTCTTGGGG - Intergenic
1199005594 X:142692946-142692968 ATTCTCTTCAGTGCCTCTTCCGG - Intergenic
1199517198 X:148691184-148691206 TTAATCTTCACACCCTTTTGGGG - Intronic
1199764727 X:150932788-150932810 TTCCTCTTCAGAAGCCCTTGGGG + Intergenic
1199986151 X:152953055-152953077 TTTCTCTTCAGTCCTCATTGAGG + Intronic