ID: 1057143902

View in Genome Browser
Species Human (GRCh38)
Location 9:92745779-92745801
Sequence CTTTCTCTTCAGACCCTCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 268
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 238}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057143902_1057143906 12 Left 1057143902 9:92745779-92745801 CCCAAGAGGGTCTGAAGAGAAAG 0: 1
1: 0
2: 1
3: 28
4: 238
Right 1057143906 9:92745814-92745836 GCTGATGATCCAGAAGTGGCTGG No data
1057143902_1057143904 -10 Left 1057143902 9:92745779-92745801 CCCAAGAGGGTCTGAAGAGAAAG 0: 1
1: 0
2: 1
3: 28
4: 238
Right 1057143904 9:92745792-92745814 GAAGAGAAAGCAAGAAAGAGAGG No data
1057143902_1057143905 8 Left 1057143902 9:92745779-92745801 CCCAAGAGGGTCTGAAGAGAAAG 0: 1
1: 0
2: 1
3: 28
4: 238
Right 1057143905 9:92745810-92745832 AGAGGCTGATGATCCAGAAGTGG No data
1057143902_1057143909 19 Left 1057143902 9:92745779-92745801 CCCAAGAGGGTCTGAAGAGAAAG 0: 1
1: 0
2: 1
3: 28
4: 238
Right 1057143909 9:92745821-92745843 ATCCAGAAGTGGCTGGGCCTGGG No data
1057143902_1057143907 13 Left 1057143902 9:92745779-92745801 CCCAAGAGGGTCTGAAGAGAAAG 0: 1
1: 0
2: 1
3: 28
4: 238
Right 1057143907 9:92745815-92745837 CTGATGATCCAGAAGTGGCTGGG No data
1057143902_1057143908 18 Left 1057143902 9:92745779-92745801 CCCAAGAGGGTCTGAAGAGAAAG 0: 1
1: 0
2: 1
3: 28
4: 238
Right 1057143908 9:92745820-92745842 GATCCAGAAGTGGCTGGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057143902 Original CRISPR CTTTCTCTTCAGACCCTCTT GGG (reversed) Intronic
902149562 1:14432023-14432045 CTTACTCTTCACACCATGTTTGG - Intergenic
903671224 1:25036732-25036754 CCTTCACATCAGACCCCCTTGGG + Intergenic
904160583 1:28519472-28519494 CTTTCTCATCAGATGCCCTTGGG + Intronic
904456825 1:30652766-30652788 CTATTTCTTCAGACCCTGCTTGG - Intergenic
904494362 1:30878335-30878357 CTTTCTCTGCAGACCTTGCTTGG - Intronic
905211046 1:36374380-36374402 CTTTCTCTGCAGGCTCTCCTGGG + Intronic
905545161 1:38791994-38792016 GTTGCTCTTCACAACCTCTTAGG + Intergenic
906263807 1:44412950-44412972 CTTTCTCTCCGGACCCTAGTGGG + Intronic
909986013 1:82161218-82161240 CATTCCCTTCAGACTCTCTCAGG - Intergenic
909989774 1:82209581-82209603 CTTTCTCTTCAACCTCTCTTTGG - Intergenic
910332706 1:86093653-86093675 TTTTCTGTGCAGAACCTCTTTGG - Intronic
912595193 1:110868728-110868750 CTTTCTGTTCAGAAGCTCTTTGG - Intergenic
914952313 1:152127127-152127149 CTTTATCTATAGACCCCCTTTGG - Intergenic
915034234 1:152909139-152909161 CTTTCTCTCCTGACCTTCTGAGG - Intronic
915802156 1:158805645-158805667 TTTTCTCTTGAGACCTCCTTGGG - Intergenic
916902072 1:169237157-169237179 CTTTCTCTCAAGACTGTCTTTGG - Intronic
918204935 1:182300030-182300052 CCTTCTCTTCTGACCCTCAGGGG - Intergenic
920393458 1:205626281-205626303 CTTTCTTTCCAGCCTCTCTTAGG + Intronic
921350597 1:214230500-214230522 CTTTCTCTCCAGACGTTTTTTGG - Intergenic
921433358 1:215088125-215088147 CTTTCACTTCATTCTCTCTTTGG + Intronic
922077928 1:222266303-222266325 CTTCCCCTTCAGACCCACCTTGG - Intergenic
922221249 1:223610251-223610273 CTTGGTCATCAGACCCTCTTTGG + Intronic
922392198 1:225156374-225156396 CTTACTCTCCAGAGACTCTTGGG + Intronic
1064029269 10:11873430-11873452 CCTGCTCTTCAGCCCCTCCTGGG + Intergenic
1065259339 10:23908523-23908545 CTTTCTCTTGGTACCCTCTCTGG + Intronic
1067231044 10:44410985-44411007 GTTTCACTCCAGACCCTATTTGG + Intergenic
1067933414 10:50586577-50586599 CTTTCTCTACAGCCCCTCCAAGG - Intronic
1068119569 10:52772029-52772051 CTTTCTCTCCATGTCCTCTTCGG + Intergenic
1069567344 10:69472625-69472647 TTTCCCCTTCAGACCCTCTTTGG - Intronic
1069622105 10:69844042-69844064 CTTTTTCTTCTGACTCTCTTGGG - Intronic
1069755788 10:70773912-70773934 CTAACTCTTCAGAAGCTCTTTGG - Intronic
1070502767 10:77087064-77087086 TGTTCTCTTCAGACCCTCAAAGG - Intronic
1070669928 10:78370565-78370587 CTTTCTCTTCAAACTCACTCAGG - Intergenic
1072128505 10:92469237-92469259 ATTTCACTTGAGACCATCTTTGG - Intronic
1074446584 10:113525839-113525861 CTTTCACTTCTGACCCCCCTGGG + Intergenic
1074555432 10:114484772-114484794 CTTTCTCCTCATCCCCTCATGGG + Intronic
1076268691 10:129131709-129131731 CTTTCTCTTGAGACCTTCCTGGG + Intergenic
1077123190 11:920342-920364 CTGTCCCATCAGACCCTCTGAGG + Intergenic
1077943884 11:6873815-6873837 CATTCTCTTCAAACCATCCTTGG - Intergenic
1079370688 11:19849517-19849539 CATTCTCTCCAGAGCCTCCTGGG + Intronic
1079676238 11:23230437-23230459 CTTTCTCTTCAAACCATCATGGG - Intergenic
1080695103 11:34596770-34596792 CTATCTCTTTATCCCCTCTTTGG - Intergenic
1084030589 11:66478451-66478473 TTCTCTCTTCTGACCCTGTTGGG + Intergenic
1089378030 11:118008710-118008732 ATCTCTCTTCAGAACATCTTGGG - Intergenic
1090099992 11:123784242-123784264 CTGTCTGTTCAGACTCTTTTTGG - Intergenic
1091075753 11:132614459-132614481 CTTCCTCTTCCGTCCCTCTGCGG + Intronic
1091170304 11:133514366-133514388 CTCTCTCTTCAGTCCCTTTTGGG - Intronic
1091415171 12:276622-276644 CTTTCTCTTCATTACTTCTTGGG - Intergenic
1091538510 12:1436682-1436704 CACTCTCTTCTGACCCTCTGAGG - Intronic
1092555773 12:9560053-9560075 CTTTCTCTTCTAACTTTCTTAGG + Intergenic
1092911742 12:13151702-13151724 CTTTCACCTCATACTCTCTTGGG - Intergenic
1094516326 12:31130624-31130646 CTTTCTCTTCTAACTTTCTTAGG - Intergenic
1095052577 12:37567499-37567521 CTTTCACTTCAGCCCCTGATTGG + Intergenic
1095171088 12:39037356-39037378 CTTTCTCTTCAGAGCTTCTTTGG - Intergenic
1095462935 12:42461356-42461378 CTTTCACATCAGTCCCTCCTTGG + Intronic
1095936331 12:47686350-47686372 TTTTCACTTCAGAGCCCCTTGGG - Intronic
1099174618 12:79406468-79406490 GGTTCTCTTCAAACCCTTTTGGG - Intronic
1099428883 12:82556994-82557016 CTTTATCCTCAGGCTCTCTTTGG + Intergenic
1100517347 12:95341185-95341207 CACTCTCTTCACACACTCTTTGG + Intergenic
1100797485 12:98197687-98197709 CTATCTCTTCAGCCCCACTCAGG - Intergenic
1101832748 12:108272065-108272087 CTTTTTCTCCAGCCCCTCTGTGG + Intergenic
1102963933 12:117111987-117112009 CTGTCTCTTCAAACCCTCCCAGG + Intergenic
1103752316 12:123173522-123173544 CTTTCTGTTCAGATCCTTCTTGG - Intronic
1103834600 12:123808775-123808797 CTTTCTCATCAACCCCTCTTAGG + Exonic
1105019475 12:132806248-132806270 CTTTGTCTTCTTATCCTCTTAGG - Intronic
1106867246 13:33978899-33978921 CTTACTTTTCACACCCTCCTGGG + Intergenic
1106964913 13:35051848-35051870 TTTTCTCTTCAGACAATTTTAGG + Intronic
1107025246 13:35795091-35795113 CTTTCTCCTCTGAACTTCTTTGG - Intronic
1107808921 13:44180676-44180698 CTTTCTATTCAGCCCCAATTAGG - Intergenic
1109860523 13:68191928-68191950 CTTTCTCTCCAGAAGCTTTTAGG + Intergenic
1111014119 13:82355075-82355097 TTTTCTCTTCAGAATCTCTAAGG + Intergenic
1111954052 13:94737760-94737782 CTGTTTCTTCATGCCCTCTTTGG + Intergenic
1114073755 14:19138278-19138300 CTTTCTCATCAGACAGTTTTAGG + Intergenic
1114088509 14:19261707-19261729 CTTTCTCATCAGACAGTTTTAGG - Intergenic
1114449636 14:22816723-22816745 CTATCTGTTCTAACCCTCTTTGG + Intronic
1114538561 14:23438296-23438318 CTTTCACTTCAGGCCTTATTTGG - Intergenic
1114571735 14:23673990-23674012 CTTTCTCTTTGCAGCCTCTTTGG + Intergenic
1116221004 14:42086539-42086561 TTTTAACTTAAGACCCTCTTCGG + Intergenic
1119395885 14:74326238-74326260 CTTTCTTTTCTGTTCCTCTTTGG - Intronic
1120486094 14:85114681-85114703 CTCGCTGTTCAGACCCACTTGGG + Intergenic
1124053734 15:26222834-26222856 CTTTCTCTTCAAACTCCCTCAGG + Intergenic
1126327582 15:47497834-47497856 CTTTCTCTTGCTTCCCTCTTTGG + Intronic
1127498361 15:59533485-59533507 CTTTCTTTGCATACTCTCTTAGG + Intergenic
1129572758 15:76706610-76706632 CTTTTTGTTCAGACCCTCTAGGG - Intronic
1131995132 15:98125832-98125854 TTCTCTCTTCAGTCCCTCCTGGG - Intergenic
1132097465 15:98998267-98998289 CCTGCTCCTCAGACCATCTTGGG + Intronic
1133698534 16:8287757-8287779 CTTTCTTATCATACCCTATTGGG - Intergenic
1134285795 16:12861042-12861064 CTTTCTCTTGAGACCTTGATTGG - Intergenic
1136183012 16:28567687-28567709 CATTCTGTTCATGCCCTCTTAGG - Intronic
1140343286 16:74186842-74186864 CTTTCTATTCAGAACCCCATAGG + Intergenic
1141679869 16:85537724-85537746 CTTTCTCGCCAGGGCCTCTTCGG - Intergenic
1141750242 16:85953546-85953568 CATTCTCTGCAGCCCTTCTTCGG + Intergenic
1141829716 16:86503271-86503293 CTTTCTCTGCTGCCCCTTTTTGG + Intergenic
1142128130 16:88420197-88420219 CTTTCTCCTCAGCCCCTCTGTGG - Intergenic
1143483629 17:7240698-7240720 CTTTCTCTCCAGCCTCTCTTAGG - Exonic
1144295944 17:13875218-13875240 CCCTCTCTTCACACACTCTTAGG - Intergenic
1144784265 17:17823256-17823278 CTCTCCCTCCAAACCCTCTTAGG + Intronic
1145373091 17:22323424-22323446 CTTTCACTTCAGCCCCTGATTGG + Intergenic
1146459208 17:33032191-33032213 CTCTCTCTTCTGACTCTTTTTGG + Intronic
1148190894 17:45677981-45678003 ATTTCTGTTCAGAGCATCTTGGG + Intergenic
1149125667 17:53228301-53228323 ATTTATTTTCATACCCTCTTCGG + Intergenic
1149657460 17:58317944-58317966 CTTTCACTACAGATGCTCTTAGG + Intronic
1150510098 17:65742781-65742803 CTTTCTCTTGAGAACCACTTTGG - Intronic
1151153997 17:72111673-72111695 CTTTCTCTGCAGCTCCTCTTGGG - Intergenic
1152013760 17:77736204-77736226 CTCTCTCTCCAGACCCTGTAGGG + Intergenic
1156179280 18:34584031-34584053 CTTTCCCTTCAAGCCTTCTTAGG + Intronic
1156617058 18:38799552-38799574 CTTTCACTTCAGCCCCTGATTGG + Intergenic
1156620919 18:38850585-38850607 CTTTCTCTGCAGACCCTTGATGG - Intergenic
1156723039 18:40093694-40093716 CCTTCTCTCCTGACCCTTTTTGG + Intergenic
1157207633 18:45714276-45714298 CTGTATCTTCAGGCCCTCTTTGG - Intergenic
1158849919 18:61485428-61485450 CTACCTCTTCTGACCCTGTTGGG + Intronic
1159135412 18:64331686-64331708 CTATGTGTTCAGACCCTCTTGGG + Intergenic
1159196092 18:65117249-65117271 CTTTCTTTTCAGAGCATCTAGGG - Intergenic
1165570487 19:36771386-36771408 CTTTCACTTCAGCCCCTGATTGG - Intronic
1165570496 19:36771421-36771443 CTTTCACTTCAGCCCCTGATTGG - Intronic
1165570512 19:36771491-36771513 CTTTCACTTCAGCCCCTAATTGG - Intronic
1165570535 19:36771596-36771618 CTTTCACTTCAGCCCCTGATTGG - Intronic
1166205275 19:41265097-41265119 CTTGTTCTTCCGACTCTCTTCGG - Intronic
1167493215 19:49803460-49803482 ACTTCTCTTCAGCCTCTCTTGGG + Intronic
925478680 2:4246963-4246985 CTTTCTCTTCAGGCACTCGAAGG + Intergenic
926744649 2:16140907-16140929 CTTTCTCTTCCTTCCCTCTCTGG - Intergenic
930603275 2:53466534-53466556 TTATCTCTTCAGACCTTCTAGGG - Intergenic
931119020 2:59196060-59196082 CTTTGGCTTCAGACACACTTGGG - Intergenic
931628323 2:64276885-64276907 TCTTCTCCTCAGACCCTCTTTGG - Intergenic
933729313 2:85445231-85445253 CTTTATCTCCGGATCCTCTTGGG - Intergenic
935225172 2:101046707-101046729 CTGGCTTTGCAGACCCTCTTTGG - Intronic
935918476 2:107984863-107984885 CTGCCTCTTCAGTCTCTCTTTGG + Intergenic
938487694 2:131729657-131729679 CTTTCTCATCAGACAGTTTTAGG + Intronic
940566781 2:155373748-155373770 CTTACTTTTCAGACACTTTTTGG + Intergenic
941883612 2:170506035-170506057 ATTTCTCTTCTGATGCTCTTTGG + Intronic
942064721 2:172259952-172259974 CCTCCTCTGCAGCCCCTCTTGGG + Intergenic
943555976 2:189404295-189404317 TGTTCTATTCAGGCCCTCTTTGG - Intergenic
946956949 2:224941375-224941397 CTTTTTCTTCACTCCCTGTTGGG + Intronic
947392733 2:229655795-229655817 CTTTCTCTTCTTCCCTTCTTAGG - Intronic
947853528 2:233307597-233307619 CTTTTTCTTCTAAACCTCTTTGG - Intergenic
948633961 2:239322182-239322204 CTTTCACTTCAGCCCCTGATTGG - Intronic
1168791097 20:576498-576520 CTTTCTCTGCCTACCCTATTTGG - Intergenic
1169842566 20:9956020-9956042 CTTTCTGTTCATCCCCTTTTAGG + Intergenic
1170001273 20:11617376-11617398 ATTTTTCTTGAGGCCCTCTTAGG - Intergenic
1171154394 20:22859124-22859146 CTTTGCCTTGTGACCCTCTTTGG - Intergenic
1171529701 20:25844897-25844919 CTTTCACTTCAGCCCCTGATTGG - Intronic
1171547125 20:26010991-26011013 CTTTCACTTCAGCCCCTGATTGG + Intergenic
1172443377 20:34980566-34980588 CTCTCTCTTCAGACCTACTCAGG + Exonic
1174529442 20:51199337-51199359 CTTTCTCTACAGGGCCTCTGTGG + Intergenic
1174686674 20:52462876-52462898 CTTTCTCTGCAAACTCTGTTTGG + Intergenic
1174698144 20:52580980-52581002 CCTTCTCATCATATCCTCTTGGG + Intergenic
1175744932 20:61449543-61449565 CCTTCTCTTCATACACTATTAGG - Intronic
1177223993 21:18230007-18230029 CTTTTTCCTCACACCTTCTTTGG - Intronic
1177820861 21:26029519-26029541 CATTCACTTCGGACCTTCTTTGG - Intronic
1179724668 21:43335455-43335477 CTTGCCCCTCAGCCCCTCTTGGG - Intergenic
1180002447 21:45001517-45001539 CTTCCTCTGCAGACACTCGTGGG - Intergenic
1180492202 22:15860630-15860652 CTTTCTCATCAGACAGTTTTAGG + Intergenic
1181665752 22:24395444-24395466 CTTTCCCCTCAGTCCCTCTCTGG - Intronic
1182097468 22:27635811-27635833 CTCTCTCTTCAGCCTCCCTTTGG + Intergenic
1183541910 22:38434322-38434344 CTCTCTCTCCAGCCCCTCTCAGG + Intronic
949684870 3:6557392-6557414 CTTTCTCATCATTCCCTCTGAGG + Intergenic
950040543 3:9916800-9916822 CGGTCCCTTCAGACACTCTTTGG - Intergenic
951498539 3:23357565-23357587 CATACTCTTCAGATCCTCTTGGG - Intronic
953349779 3:42206859-42206881 CTTTCTCTTCAGCCCATCCTTGG + Intronic
954719721 3:52550962-52550984 CTTTCTATTCAAATCCTATTGGG - Intronic
955275833 3:57546051-57546073 CTTTCTCTTCAGTTCCTGATAGG + Intergenic
955929915 3:64046231-64046253 CTTTCTCCTCTGACCCTGTGAGG + Intergenic
957122344 3:76111338-76111360 CTTTCTACTCAGACTCTCTCTGG + Intronic
961038532 3:123660651-123660673 CTTTCTTTTCAGATCCTCTCTGG - Intronic
962011141 3:131392102-131392124 CTCTCTCTTCAGATCATCTCAGG + Intergenic
963006381 3:140729679-140729701 CTTTCTCTTCACAGCCTCAATGG - Intergenic
963048758 3:141124472-141124494 CATCCTCATCAGACCCTCCTAGG - Intronic
963641685 3:147868061-147868083 CTTTCTTTTCAAACCCAATTTGG + Intergenic
963826661 3:149962653-149962675 TTTTCTCCTCACACCCTCTTAGG - Intronic
964327239 3:155560849-155560871 TTTTATCTTCAGACTCCCTTTGG + Intronic
966042406 3:175507861-175507883 CTTTTTCTTCATACTCTGTTAGG + Intronic
967077117 3:186013584-186013606 CTTTCTCTCCAGACTCCCTGGGG + Intergenic
967283309 3:187843584-187843606 CCTTCTCTTCTGAACCTCTATGG + Intergenic
968229256 3:196995660-196995682 CCTTCTCTTCCTGCCCTCTTTGG - Intronic
968406304 4:342336-342358 CATTCTCTGCAGACCCTATAAGG - Intronic
969981902 4:11166078-11166100 ATTTCTCTTCACAGCGTCTTGGG - Intergenic
970148724 4:13066675-13066697 GCTTAACTTCAGACCCTCTTTGG - Intergenic
970798517 4:19944563-19944585 GTTTCTCATCAAACCCTCCTTGG - Intergenic
971219336 4:24690824-24690846 CTCACTCTCCAGACCCTCTGGGG + Intergenic
973649866 4:52987946-52987968 CTTTCTCTTCATATGCACTTTGG - Intronic
975216850 4:71765545-71765567 CTTTCGTTCCAGGCCCTCTTTGG + Exonic
984310979 4:178057475-178057497 CTTTATCTTAAGAGCCTCATTGG - Intergenic
984652416 4:182284880-182284902 CTTTTTCTTAAAACCATCTTTGG + Intronic
984814899 4:183826804-183826826 CTTTCTCTTCTGAGGGTCTTTGG - Intergenic
985829899 5:2220595-2220617 CTTTTTCTTCAGTCCCTTGTGGG - Intergenic
987151363 5:15044131-15044153 CTTACTGTTCCTACCCTCTTGGG + Intergenic
987452697 5:18106042-18106064 CTTTCACTGCAGACCCACCTTGG + Intergenic
987471139 5:18329745-18329767 TTTTCTCTTCTGCCACTCTTTGG + Intergenic
988273695 5:29052880-29052902 CATTCTCTGAAGTCCCTCTTTGG + Intergenic
988523526 5:31966873-31966895 CTTTCTTTTCAGAGGCTCTGTGG - Intronic
989270029 5:39522220-39522242 CCTTCTCTTCAAACTTTCTTGGG + Intergenic
991034898 5:62119392-62119414 CGTTCTCTTCAGGCCCTCAAGGG + Intergenic
994238316 5:97391562-97391584 TTCTCTCTTCAGCCCCACTTTGG - Intergenic
994781727 5:104097479-104097501 CTTTGTCTTCTGTCTCTCTTAGG + Intergenic
995976091 5:118036509-118036531 CTTTCTCTTTACATCATCTTAGG - Intergenic
998177471 5:139910868-139910890 CTTCATTTTCAGACCCTCTTTGG + Intronic
999829639 5:155306410-155306432 CCTTCCCTGCACACCCTCTTTGG - Intergenic
1000351568 5:160356778-160356800 CTTTCCCTTCAGACTCTGCTTGG + Intronic
1001043518 5:168353791-168353813 CTTCCTCTACAGAACCTCCTGGG + Intronic
1001675457 5:173509392-173509414 CTTTCTCTTCAGAATTGCTTTGG + Intergenic
1003452998 6:6254163-6254185 CCATCTCTTCATACCCTCATTGG - Intronic
1003488287 6:6598469-6598491 CTATCTCTTCAGATCATCTGAGG + Intronic
1005848715 6:29802428-29802450 CTTTCACTTCAGGCCCTCTAAGG - Intergenic
1005860723 6:29897798-29897820 CCTTCACTTCAGGCCCTCTAAGG - Intergenic
1006153500 6:32001755-32001777 CCTTCTCCTCACCCCCTCTTAGG + Exonic
1006159808 6:32034492-32034514 CCTTCTCCTCACCCCCTCTTAGG + Exonic
1006398056 6:33799901-33799923 CTTTCTCTAATGACACTCTTGGG + Intronic
1007806791 6:44456369-44456391 CTCTCTGTCCAGGCCCTCTTGGG + Intergenic
1008430417 6:51410353-51410375 GTTTTTCTTCAGACTCTCTTAGG + Intergenic
1008565812 6:52766784-52766806 CTCTCTCTCCAGTCTCTCTTGGG + Intergenic
1008569999 6:52807120-52807142 CTCTCTCTCCAGTCTCTCTTGGG + Intergenic
1013160217 6:107536391-107536413 ATTTCTCTTCACACACGCTTGGG + Intronic
1016003183 6:139063036-139063058 CTTTGGCTTAAGACACTCTTGGG + Intergenic
1018019286 6:159743681-159743703 GTTTTTCTTCAGACTCTCTTAGG - Exonic
1018625801 6:165777595-165777617 CTGTGGCTTCAAACCCTCTTGGG + Intronic
1018896936 6:168026028-168026050 CTTCCTCTTCAGGTCCTCCTGGG - Intronic
1020354857 7:7265031-7265053 CTTCCTCTTCTGCCCCTCTTTGG - Intergenic
1020882118 7:13775343-13775365 CTTTCTTTTCAGACAGACTTTGG - Intergenic
1021172202 7:17412895-17412917 TGTTCTCTTCAGGCCCTCATTGG - Intergenic
1022201824 7:28124403-28124425 CTTTCTCTCGAGAACCGCTTGGG - Intronic
1024584759 7:50832481-50832503 CAGTCTCTCCACACCCTCTTTGG - Intergenic
1024612943 7:51082746-51082768 CTCTCTCTACAGACACTCTGAGG + Intronic
1027421815 7:78024262-78024284 CTTTCTCTGCATTCCCTCCTAGG + Intronic
1027708070 7:81559705-81559727 CTTCCTCTTCTCACCCTCTCTGG - Intergenic
1028236349 7:88366854-88366876 CTTTATCTTTAGCCCCTGTTTGG - Intergenic
1029216523 7:98954407-98954429 CTTTCTCTTGTGAACCTCTGTGG + Intronic
1032071004 7:128806973-128806995 CTTTCTCCTAAGCACCTCTTTGG - Intronic
1033656633 7:143379965-143379987 CTTTCTCTTCATAAACTTTTGGG + Intergenic
1035766936 8:2113829-2113851 CTTTCTCATCAGAACCTTGTTGG + Intronic
1036514850 8:9434294-9434316 CTTTCACTTCAGCCCCTGGTTGG + Intergenic
1040411255 8:47156877-47156899 CTTTCTGTGCAGAAGCTCTTTGG - Intergenic
1041087644 8:54271606-54271628 CTTTCTCTTCTGCCCTTCCTGGG + Intergenic
1043249419 8:78052258-78052280 TTTTCACTTCAGACCTTTTTTGG + Intergenic
1043257279 8:78151718-78151740 CTTTCTCTCCACAACCTCTCTGG + Intergenic
1043804981 8:84660819-84660841 CTTTCTTTTCAAATTCTCTTGGG - Intronic
1045031652 8:98142707-98142729 CTTTCCCTTTAAACACTCTTTGG + Intronic
1045712017 8:104995939-104995961 CTTTCTCGTCACTCCGTCTTCGG + Intronic
1046622991 8:116547499-116547521 ATTTCCCTTCAGAACCTCTGTGG - Intergenic
1047763322 8:127970199-127970221 CTGTCTCCTCAGACCCTCAGGGG + Intergenic
1047824360 8:128557385-128557407 TTTTCTCTGCAGAACCTCATAGG - Intergenic
1050430915 9:5560657-5560679 CCTTCTCTTCAGTTCCTCTTAGG + Intronic
1051189940 9:14500774-14500796 GTTTCTCTTCATGCCATCTTGGG + Intergenic
1051872038 9:21749208-21749230 CTTGCTCTACAGCCCCGCTTCGG - Intergenic
1053797681 9:41741182-41741204 CTTTCACTTCAGCCCCTGATTGG - Intergenic
1054147511 9:61573775-61573797 CTTTCACTTCAGCCCCTGATTGG + Intergenic
1054467256 9:65504813-65504835 CTTTCACTTCAGCCCCTGCTTGG + Intergenic
1054652411 9:67635288-67635310 CTTTCACTTCAGCCCCTGATTGG + Intergenic
1055141686 9:72883570-72883592 CTTTTTCTTCTGCCCATCTTGGG - Intergenic
1055460171 9:76512017-76512039 CTTTCTCTCCACACACCCTTTGG - Intergenic
1057054764 9:91951610-91951632 CCTTCTCTGCAGCCCCTGTTGGG - Intergenic
1057143902 9:92745779-92745801 CTTTCTCTTCAGACCCTCTTGGG - Intronic
1057402755 9:94739248-94739270 GGTTGTCTTCAGACCCTTTTGGG + Intronic
1061533125 9:131230220-131230242 ATTTATCTTCAGCTCCTCTTGGG - Intronic
1203777184 EBV:80127-80149 CTTTCTCTTCGTACCCTTCTGGG - Intergenic
1186211825 X:7257494-7257516 TTTCCTCTTCACAGCCTCTTCGG + Exonic
1186747742 X:12586903-12586925 CATTTTCTTCAGTGCCTCTTTGG - Intronic
1188697211 X:33208632-33208654 ATTTCTAATTAGACCCTCTTAGG + Intronic
1189563337 X:42213788-42213810 CCTCCTGTTCTGACCCTCTTGGG - Intergenic
1192833244 X:74772540-74772562 TTTTCTCTCCAGCCCCTCCTTGG + Intronic
1193458793 X:81764717-81764739 CCTTCTGTTCTGGCCCTCTTGGG - Intergenic
1193745606 X:85275829-85275851 CTGGCTCATCAGACCCTTTTAGG + Intergenic
1195694374 X:107655815-107655837 CCTTCTCTTCACTCGCTCTTTGG - Intergenic
1196081899 X:111641497-111641519 CATTCTCTTCACAACCTCTTAGG + Intergenic
1199550108 X:149051686-149051708 CTTTTTCTCCATAACCTCTTCGG - Intergenic
1199764726 X:150932787-150932809 CTTCCTCTTCAGAAGCCCTTGGG + Intergenic
1200130372 X:153840067-153840089 ATTTGTCTTTATACCCTCTTCGG + Intergenic
1200276438 X:154737443-154737465 CTTACTCATCACACCCTCCTTGG + Intronic
1201420490 Y:13793708-13793730 CTTCCCCTTCAGACCCCCTGTGG + Intergenic