ID: 1057143903

View in Genome Browser
Species Human (GRCh38)
Location 9:92745780-92745802
Sequence GCTTTCTCTTCAGACCCTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 3, 3: 9, 4: 212}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057143903_1057143911 30 Left 1057143903 9:92745780-92745802 CCAAGAGGGTCTGAAGAGAAAGC 0: 1
1: 0
2: 3
3: 9
4: 212
Right 1057143911 9:92745833-92745855 CTGGGCCTGGGCCTAGACCCTGG No data
1057143903_1057143907 12 Left 1057143903 9:92745780-92745802 CCAAGAGGGTCTGAAGAGAAAGC 0: 1
1: 0
2: 3
3: 9
4: 212
Right 1057143907 9:92745815-92745837 CTGATGATCCAGAAGTGGCTGGG No data
1057143903_1057143905 7 Left 1057143903 9:92745780-92745802 CCAAGAGGGTCTGAAGAGAAAGC 0: 1
1: 0
2: 3
3: 9
4: 212
Right 1057143905 9:92745810-92745832 AGAGGCTGATGATCCAGAAGTGG No data
1057143903_1057143908 17 Left 1057143903 9:92745780-92745802 CCAAGAGGGTCTGAAGAGAAAGC 0: 1
1: 0
2: 3
3: 9
4: 212
Right 1057143908 9:92745820-92745842 GATCCAGAAGTGGCTGGGCCTGG No data
1057143903_1057143906 11 Left 1057143903 9:92745780-92745802 CCAAGAGGGTCTGAAGAGAAAGC 0: 1
1: 0
2: 3
3: 9
4: 212
Right 1057143906 9:92745814-92745836 GCTGATGATCCAGAAGTGGCTGG No data
1057143903_1057143909 18 Left 1057143903 9:92745780-92745802 CCAAGAGGGTCTGAAGAGAAAGC 0: 1
1: 0
2: 3
3: 9
4: 212
Right 1057143909 9:92745821-92745843 ATCCAGAAGTGGCTGGGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057143903 Original CRISPR GCTTTCTCTTCAGACCCTCT TGG (reversed) Intronic
900439366 1:2645680-2645702 GCTGGGTGTTCAGACCCTCTAGG - Intronic
901180981 1:7341711-7341733 GCGTTATCTTCAGACAGTCTGGG + Intronic
901206604 1:7501154-7501176 GCATTCTCCCCAGACCCTCCAGG + Intronic
903947503 1:26972865-26972887 TCTTTCTCTTCTGACTCTCTAGG - Intergenic
904258871 1:29275608-29275630 GCTCTGTCTTCACACACTCTCGG - Exonic
904380645 1:30108381-30108403 TCTTTCCTTTCAGACCCGCTGGG - Intergenic
904906404 1:33900346-33900368 TCTTTCTCTTCTGCTCCTCTGGG - Intronic
905211045 1:36374379-36374401 GCTTTCTCTGCAGGCTCTCCTGG + Intronic
905480809 1:38260751-38260773 GGTTTCTCTACAGACCCACAAGG + Intergenic
905794980 1:40810671-40810693 TCTCTCTCTTCATACCCACTGGG - Intronic
909527685 1:76644971-76644993 GCTCTCCCTACAGAACCTCTGGG + Intergenic
909808430 1:79900857-79900879 GTGTTCTATTCAGACCCTCAAGG + Intergenic
910226448 1:84940842-84940864 GCATTCTCTTCCTGCCCTCTTGG - Intronic
910844854 1:91595046-91595068 TCATTCTCTTCAGTCACTCTGGG + Intergenic
913195171 1:116450303-116450325 GCTTCCCCTTTAGACGCTCTGGG - Intergenic
913665239 1:121042246-121042268 GCTTTCTCTTAACACCTTCCTGG - Intergenic
914016631 1:143825515-143825537 GCTTTCTCTTAACACCTTCCTGG - Intergenic
914161154 1:145135496-145135518 GCTTTCTCTTAACACCTTCTTGG + Intergenic
914655245 1:149734056-149734078 GCTTTCTCTTAATACCTTCCTGG - Intergenic
915674315 1:157516113-157516135 ACTTTCTCTTGAGGGCCTCTAGG - Intronic
918204937 1:182300031-182300053 TCCTTCTCTTCTGACCCTCAGGG - Intergenic
918359011 1:183735916-183735938 GCTGTATCTTGAGACCTTCTTGG + Intronic
918374079 1:183891286-183891308 GTTTTCTCTACACACCCTCCAGG - Intronic
920949373 1:210557955-210557977 GAATGCTCTTCTGACCCTCTAGG - Intronic
922015813 1:221645542-221645564 GTTTGCTCTTAGGACCCTCTAGG + Intergenic
922392197 1:225156373-225156395 GCTTACTCTCCAGAGACTCTTGG + Intronic
923501440 1:234568529-234568551 TCTTACTCCTCTGACCCTCTTGG - Intergenic
1064029267 10:11873429-11873451 GCCTGCTCTTCAGCCCCTCCTGG + Intergenic
1064405796 10:15061355-15061377 GCCTTATCTCCTGACCCTCTAGG + Intronic
1065329148 10:24575441-24575463 GCTTTGTTGACAGACCCTCTTGG - Intergenic
1066470262 10:35691049-35691071 GCTTTCTATTTAGACCTTCCAGG + Intergenic
1066508364 10:36067626-36067648 GAGTTCTCTTCATACCCACTGGG - Intergenic
1067777469 10:49173973-49173995 GATTTCTTTTCTGAGCCTCTTGG - Intronic
1069622106 10:69844043-69844065 TCTTTTTCTTCTGACTCTCTTGG - Intronic
1070220723 10:74441223-74441245 GCTTTATCTTAACACCCACTAGG + Intronic
1073741178 10:106408821-106408843 GGATTCTCTGCAGATCCTCTGGG - Intergenic
1074182676 10:111077785-111077807 GCTCGCGCTTCAGACGCTCTCGG - Exonic
1074446583 10:113525838-113525860 GCTTTCACTTCTGACCCCCCTGG + Intergenic
1076268690 10:129131708-129131730 CCTTTCTCTTGAGACCTTCCTGG + Intergenic
1079676239 11:23230438-23230460 TCTTTCTCTTCAAACCATCATGG - Intergenic
1083169604 11:60915000-60915022 GCTTTCTCGTTCGACCCTCACGG + Intronic
1083347243 11:62002131-62002153 GTTTTCTCTTCAGTGCCTCATGG - Intergenic
1084030588 11:66478450-66478472 GTTCTCTCTTCTGACCCTGTTGG + Intergenic
1085459503 11:76684999-76685021 GGTTTCTCCACAGGCCCTCTGGG - Intergenic
1085787353 11:79465290-79465312 GCTGTATCTCCAGACCCACTGGG + Intergenic
1086308965 11:85514751-85514773 CCTTTCTTTTCATACGCTCTTGG + Intronic
1089752778 11:120663119-120663141 GATTTTGCTTCAGTCCCTCTGGG + Intronic
1089792228 11:120953460-120953482 GCTTTCTCTGCAGACAGCCTGGG + Intronic
1090076147 11:123581161-123581183 GCTTGCTCTTCAGACCTTCTAGG + Intronic
1090452645 11:126820326-126820348 GCTTTATCTTCAGACCTTCTTGG - Intronic
1091170305 11:133514367-133514389 CCTCTCTCTTCAGTCCCTTTTGG - Intronic
1092911743 12:13151703-13151725 GCTTTCACCTCATACTCTCTTGG - Intergenic
1096621889 12:52870460-52870482 CCTGTCGCTTCAGAGCCTCTGGG + Intergenic
1096658451 12:53106046-53106068 CCTATCTGATCAGACCCTCTGGG + Intronic
1098621977 12:72612311-72612333 GCTTTCCCTTCATAGCATCTGGG + Intronic
1099993790 12:89754747-89754769 CCTTCCTATTCAGAGCCTCTTGG + Intergenic
1102093495 12:110215265-110215287 GCTTGCTTTTCTGTCCCTCTTGG + Intronic
1103711656 12:122917390-122917412 GTTTGCTCTTCAAACACTCTAGG - Intergenic
1105287468 13:19017248-19017270 GCATTCTCATCAGACCCCCCTGG + Intergenic
1106014008 13:25851003-25851025 GCTATCTTTTCAGAGGCTCTTGG + Intronic
1106268137 13:28128188-28128210 TGATTCTCTTCAGACACTCTTGG + Intergenic
1114451930 14:22832638-22832660 GTTTTGTCTTCAGAAACTCTTGG - Intronic
1114520545 14:23331838-23331860 GATACCTCTTCATACCCTCTAGG - Intergenic
1114825751 14:26076908-26076930 GATTTCATTTCACACCCTCTAGG + Intergenic
1115004677 14:28468030-28468052 GGCTTAACTTCAGACCCTCTGGG + Intergenic
1115256793 14:31411654-31411676 GCTCTATCTGCACACCCTCTTGG - Intronic
1115819668 14:37200447-37200469 GTTTTCCCCTCACACCCTCTTGG - Intronic
1116309015 14:43297152-43297174 GTTTACTCTTCAGTGCCTCTAGG - Intergenic
1118456337 14:65948401-65948423 GCTTGCTCTTCCTCCCCTCTGGG - Intergenic
1118896556 14:69950129-69950151 GCTTTCTCTTCAGACACCTTGGG - Intronic
1119991949 14:79208019-79208041 CCTTCCTCTTTATACCCTCTGGG - Intronic
1120554893 14:85917719-85917741 GCTTTCTCTACAGTTGCTCTTGG + Intergenic
1121740445 14:96248448-96248470 GCTTCTCCTTCAGACCCTCCAGG + Intronic
1129572759 15:76706611-76706633 TCTTTTTGTTCAGACCCTCTAGG - Intronic
1129945154 15:79533314-79533336 GCATCTTCTTCAGACCATCTTGG - Intergenic
1132676101 16:1121854-1121876 GCTTTCTCACCAGGGCCTCTAGG - Intergenic
1135280373 16:21149303-21149325 GCTTTCACTTCAGAGCATATTGG + Intronic
1138208718 16:55144872-55144894 GCTTTCTATTCATAGACTCTTGG - Intergenic
1139180767 16:64745763-64745785 GGTTTCTCAATAGACCCTCTTGG + Intergenic
1139268393 16:65660402-65660424 GCTTCATCATCACACCCTCTAGG + Intergenic
1143020078 17:3912941-3912963 GCTTTCTCTCCAGTCCCTCTGGG - Intronic
1143511050 17:7395090-7395112 GCTTCCTCCTCTGGCCCTCTAGG - Exonic
1143877506 17:10003266-10003288 GCTTTCTTTACTGCCCCTCTGGG - Intronic
1144889274 17:18484723-18484745 GACCTCTCTTAAGACCCTCTGGG + Intronic
1145142934 17:20459573-20459595 GACCTCTCTTAAGACCCTCTGGG - Intronic
1148132474 17:45270473-45270495 GCTCTTTCCTCAGCCCCTCTTGG + Exonic
1148547250 17:48527759-48527781 TCTTCCTCTCAAGACCCTCTGGG + Intergenic
1148968285 17:51456401-51456423 ACTTTCCTTTCAGACCCTTTGGG + Intergenic
1151119426 17:71775906-71775928 GCCTTCTATTCAGAACCACTGGG + Intergenic
1151153998 17:72111674-72111696 CCTTTCTCTGCAGCTCCTCTTGG - Intergenic
1152002180 17:77653881-77653903 GCTTTATCTTCAGACCTTTAAGG - Intergenic
1152013759 17:77736203-77736225 CCTCTCTCTCCAGACCCTGTAGG + Intergenic
1154032870 18:10768340-10768362 GACTTCTCTTCAGACCCTCATGG - Intronic
1155052783 18:22163424-22163446 CCTTTCTTTTCAAACCCGCTGGG + Intergenic
1155205548 18:23555060-23555082 TCTTTGTCTTCTGACCCTCAGGG - Intronic
1156076195 18:33282300-33282322 GCTCTCGCTCCAAACCCTCTGGG - Intronic
1156129906 18:33959366-33959388 ATTTTCTCTTGGGACCCTCTAGG + Intronic
1156410591 18:36824562-36824584 GATTTCACTTCACACCCACTAGG - Intronic
1158406088 18:57160937-57160959 GCTTTCTCTGCAGACCCAAGAGG - Intergenic
1158678508 18:59545109-59545131 CCTTTCTCTTTATGCCCTCTAGG - Intronic
1159135411 18:64331685-64331707 TCTATGTGTTCAGACCCTCTTGG + Intergenic
1159196093 18:65117250-65117272 CCTTTCTTTTCAGAGCATCTAGG - Intergenic
1159804693 18:72941832-72941854 GATTTCTCCTAATACCCTCTGGG + Intergenic
1161278770 19:3433913-3433935 GCTTTCTCTGCTGACCTGCTGGG + Intronic
1168101323 19:54142938-54142960 GCACTCTCTTCATACTCTCTTGG - Exonic
1168628060 19:57934547-57934569 GCTTTCCCCTCAGACACTCCTGG - Intronic
925230914 2:2233237-2233259 GTTTTCTCTTTGGACCCTCCTGG - Intronic
928252096 2:29689946-29689968 GATTTCTCTTCAGAGCCTCCGGG + Intronic
928452294 2:31387729-31387751 GCTTTATTTTCATACCCACTGGG - Intronic
930603276 2:53466535-53466557 TTTATCTCTTCAGACCTTCTAGG - Intergenic
931119021 2:59196061-59196083 GCTTTGGCTTCAGACACACTTGG - Intergenic
931652425 2:64480496-64480518 GCTTTACCTTCAGACCGTCCAGG - Intergenic
932568647 2:72924988-72925010 GCTTTCTCCCCAGACGCTCCTGG - Intronic
935528521 2:104203135-104203157 GTTGTCTCTTCTGAACCTCTGGG - Intergenic
935626598 2:105176802-105176824 GCTTTTTCTTCTGCCCCTCCTGG + Intergenic
937922817 2:127143868-127143890 ACTTTCTCTCCTGACCCTCCTGG - Intergenic
938636623 2:133234720-133234742 GCCTTCTCTTGTCACCCTCTAGG - Intronic
940834008 2:158500254-158500276 GCTTTCTCTACAGAAACACTGGG - Intronic
945984361 2:216341938-216341960 ACCTTCTCATCTGACCCTCTGGG - Intronic
946201916 2:218075540-218075562 GCTCCCTCTACAGCCCCTCTGGG - Exonic
946464967 2:219903736-219903758 GCTGTTTCTCCAGACCGTCTAGG - Intergenic
946956948 2:224941374-224941396 GCTTTTTCTTCACTCCCTGTTGG + Intronic
1170551825 20:17483497-17483519 GCTTTGTCTTCAGCCTCTCCAGG + Exonic
1170617304 20:17964333-17964355 GTTTTCTCTCCAGACCATATAGG + Intronic
1171349541 20:24492169-24492191 GCCTTCTCTCCACACCCCCTTGG + Intronic
1174345463 20:49925930-49925952 GATTCCACTTCAAACCCTCTAGG + Intergenic
1174698142 20:52580979-52581001 GCCTTCTCATCATATCCTCTTGG + Intergenic
1175483987 20:59331620-59331642 GCCAGCTCTCCAGACCCTCTGGG - Intergenic
1177244192 21:18501476-18501498 GCTTTCTCTTCATGTTCTCTAGG - Intergenic
1177850573 21:26342580-26342602 GCTTTCTCTTCTGGATCTCTGGG - Intergenic
1178993303 21:37373709-37373731 GATTTTTCTTCATACCCTATTGG + Intronic
1179145163 21:38761617-38761639 GCTTTCCCTGCAGCCGCTCTGGG - Intergenic
1180835667 22:18928366-18928388 GCTGTCTCTGAAGACCCCCTGGG - Intronic
1180922064 22:19526080-19526102 CCTTCCTCTACAGACCCTCCTGG + Intronic
1181051456 22:20240119-20240141 GCTCCCTCTGCAGCCCCTCTGGG - Intergenic
1181575591 22:23792463-23792485 GGGTGCTCTTCAGACACTCTGGG + Intronic
1184966954 22:47983738-47983760 GATATCTCTTCAAACCTTCTAGG - Intergenic
1203285756 22_KI270734v1_random:153665-153687 GCTGTCTCTGAAGACCCCCTGGG - Intergenic
949187107 3:1205199-1205221 GATTTCACTCCAGAGCCTCTAGG + Intronic
950226294 3:11237433-11237455 ACTTGCTCTTCAGTCACTCTGGG + Intronic
950772610 3:15324213-15324235 GTTATCTCTTCAGACTATCTGGG + Intronic
951498540 3:23357566-23357588 TCATACTCTTCAGATCCTCTTGG - Intronic
955492591 3:59498291-59498313 GCTTTCTCTTCTAACCTCCTAGG + Intergenic
956970158 3:74513839-74513861 ACTTTCTCTTTATACCATCTGGG - Intronic
958588119 3:96117889-96117911 ACTTTTTCTCCAGAGCCTCTGGG - Intergenic
958952028 3:100427189-100427211 GCTTTCTCTTCCTTCCCACTTGG + Intronic
961413890 3:126743605-126743627 GCTTTCTCTTCAGCCTCTTGAGG + Intronic
961505507 3:127368490-127368512 GCTTTCTCTTCTCACCCTGCAGG - Intergenic
961702125 3:128753091-128753113 GATTTCTCTTCAGAACCTTCAGG + Intronic
961848813 3:129794368-129794390 GCTTTGTCTGAAGATCCTCTGGG - Intronic
962362069 3:134750803-134750825 GCTTTCTCTGGAGACTCTGTTGG - Intronic
962444480 3:135452484-135452506 GCTTTCTCTGCAGGACCTCCTGG + Intergenic
962666099 3:137654794-137654816 GCTCTCTCTTCAGAGCTTCTAGG - Intergenic
964078755 3:152725162-152725184 TCTGTCTCTTCTGACCATCTGGG + Intergenic
967077116 3:186013583-186013605 CCTTTCTCTCCAGACTCCCTGGG + Intergenic
968311132 3:197683877-197683899 GCTCTCTTTTGAGACCTTCTGGG + Intronic
970270828 4:14345498-14345520 GCTGTCTCTTCTGCCACTCTGGG + Intergenic
971219335 4:24690823-24690845 CCTCACTCTCCAGACCCTCTGGG + Intergenic
973661748 4:53114541-53114563 GATTTCTCATCAGAACCTCTTGG + Intronic
975992140 4:80268178-80268200 GGTTTCTCTTCACTGCCTCTAGG + Intronic
976810963 4:89100882-89100904 GGTTGCTCTTCAAACCCTGTGGG - Intronic
978375804 4:108074397-108074419 CTTTTCTCTTCAGACCTTCCTGG - Intronic
979708458 4:123749356-123749378 CCTTTCTTTTCAGACCCTGGAGG - Intergenic
980269889 4:130570449-130570471 GCCTTATCTTCAGACCCGGTAGG - Intergenic
980945654 4:139317791-139317813 GTTCTCTCTTCAAACTCTCTTGG + Intronic
983203822 4:164890917-164890939 GTTGTCACTTCACACCCTCTAGG - Intronic
985829900 5:2220596-2220618 GCTTTTTCTTCAGTCCCTTGTGG - Intergenic
988666229 5:33330825-33330847 CCTTTCCCTTCAGAACCCCTTGG + Intergenic
991034897 5:62119391-62119413 TCGTTCTCTTCAGGCCCTCAAGG + Intergenic
992147399 5:73865101-73865123 GCTTTCTGTTGAGACCTGCTTGG + Intronic
996450347 5:123614979-123615001 GCTTTTTCCTCAGTACCTCTGGG - Exonic
1000759609 5:165206144-165206166 TCTTTATCTTCAGCCACTCTGGG - Intergenic
1001043517 5:168353790-168353812 GCTTCCTCTACAGAACCTCCTGG + Intronic
1001541779 5:172544886-172544908 GCATCCTCTTCAGAGCCTCCTGG - Intergenic
1001658147 5:173369900-173369922 GCTCCTTCTTCAGGCCCTCTGGG + Intergenic
1001702060 5:173713850-173713872 GTTCTCTCTCCAGACCCCCTGGG - Intergenic
1006398055 6:33799900-33799922 GCTTTCTCTAATGACACTCTTGG + Intronic
1009032389 6:58075395-58075417 GCTTTCTCCTCAGACAGTCAGGG + Intergenic
1010550500 6:77216551-77216573 GCTGTCTCTTCTGACCCTTAAGG + Intergenic
1013927162 6:115487115-115487137 GCTCTCTCTTGAAACCATCTAGG + Intergenic
1014637311 6:123863605-123863627 GATTACTATTCAGGCCCTCTTGG + Intronic
1015687447 6:135880931-135880953 GTTTTCTCTTCAGCATCTCTGGG - Intronic
1017304455 6:152899881-152899903 GCTTTCTCTCCTGAGCCTCTGGG + Intergenic
1018896937 6:168026029-168026051 GCTTCCTCTTCAGGTCCTCCTGG - Intronic
1019722964 7:2584238-2584260 GCATCGTCTCCAGACCCTCTTGG + Exonic
1020073289 7:5241388-5241410 GCTCTCTCCTCAGGCTCTCTCGG - Intergenic
1020853303 7:13384801-13384823 GCTCTCAATTCAGACCTTCTTGG - Intergenic
1020877740 7:13719400-13719422 ACTTTCACTTCACATCCTCTGGG - Intergenic
1020879516 7:13742036-13742058 CCTTTCTCTTTAAAGCCTCTGGG + Intergenic
1023649429 7:42352890-42352912 GCTTTCTCATAAGACAGTCTTGG - Intergenic
1024410205 7:49031721-49031743 GATTTTTCTTCAGAGCCTCCAGG + Intergenic
1024412283 7:49059004-49059026 GTTTTCCATTCAGCCCCTCTAGG + Intergenic
1024828838 7:53424407-53424429 GCTTTGCCTTCAGCCCCTGTGGG - Intergenic
1032100828 7:128975762-128975784 GCTAGGCCTTCAGACCCTCTAGG + Intronic
1032488288 7:132304990-132305012 GCCTTCTCTTCCCACACTCTGGG + Intronic
1032732755 7:134660149-134660171 GTTTTCCCTTCAGAATCTCTAGG + Intronic
1033656632 7:143379964-143379986 GCTTTCTCTTCATAAACTTTTGG + Intergenic
1037578954 8:20233473-20233495 GCCTTCTCTTCAGAGCCACGGGG + Intergenic
1037730960 8:21523838-21523860 GCTTCCTCTGCAGTCCCTCCAGG - Intergenic
1038986997 8:32822290-32822312 ACTTTCTCTTCATCCCCTATTGG + Intergenic
1041971791 8:63751776-63751798 GCTTTCTCTTCACACCCAAGAGG - Intergenic
1042975183 8:74460924-74460946 GCTTTCTCTTCCCACTTTCTTGG + Intronic
1044461508 8:92450178-92450200 GCTTTCTCTTCAAACCCAACTGG - Intergenic
1045976187 8:108132611-108132633 GGTTTCTCTTCACACCCTTGGGG + Intergenic
1046577692 8:116051514-116051536 TCTTTCTCTACATACTCTCTGGG + Intergenic
1046594882 8:116249508-116249530 GCTTTCTCTTTATACCTCCTTGG - Intergenic
1046836757 8:118810219-118810241 GTTTTGTTTTCAGATCCTCTAGG - Intergenic
1047763321 8:127970198-127970220 TCTGTCTCCTCAGACCCTCAGGG + Intergenic
1048920558 8:139226037-139226059 GCTTTCTCCTGACACCCACTGGG - Intergenic
1050778336 9:9297158-9297180 CCTTTATCTCCAGAGCCTCTTGG + Intronic
1055357673 9:75454187-75454209 ACTTTCCCATCAGAGCCTCTAGG + Intergenic
1056288192 9:85112605-85112627 GCACTCTCTCCAGACACTCTAGG - Intergenic
1057143903 9:92745780-92745802 GCTTTCTCTTCAGACCCTCTTGG - Intronic
1057851234 9:98568389-98568411 GCTGGCTCTTCTGAGCCTCTGGG - Intronic
1058108642 9:101004464-101004486 ACTCTCTTTTCTGACCCTCTGGG - Intergenic
1060188782 9:121579374-121579396 CCTGTCTCTTCATCCCCTCTCGG + Intronic
1062115151 9:134804739-134804761 GCCTTCTCATCAGACACTCCTGG - Intronic
1062156028 9:135049078-135049100 GCCTTCTTTTCAGGCACTCTCGG - Intergenic
1203777185 EBV:80128-80150 GCTTTCTCTTCGTACCCTTCTGG - Intergenic
1187748062 X:22431399-22431421 GTTTTCTCTTAAAGCCCTCTGGG + Intergenic
1188801856 X:34542140-34542162 ACTTTCTTTTCAGATTCTCTAGG + Intergenic
1194071223 X:89328659-89328681 GCTTCCTACTCAGGCCCTCTAGG + Intergenic
1194823473 X:98532681-98532703 TCCTTCTCTTCAGAGCATCTAGG - Intergenic
1195803486 X:108736768-108736790 GCTTTCTCCTCCGCCCCTCCAGG - Intergenic
1200725453 Y:6664397-6664419 GCTTCCTACTCAGCCCCTCTAGG + Intergenic