ID: 1057143908

View in Genome Browser
Species Human (GRCh38)
Location 9:92745820-92745842
Sequence GATCCAGAAGTGGCTGGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057143903_1057143908 17 Left 1057143903 9:92745780-92745802 CCAAGAGGGTCTGAAGAGAAAGC 0: 1
1: 0
2: 3
3: 9
4: 212
Right 1057143908 9:92745820-92745842 GATCCAGAAGTGGCTGGGCCTGG No data
1057143902_1057143908 18 Left 1057143902 9:92745779-92745801 CCCAAGAGGGTCTGAAGAGAAAG 0: 1
1: 0
2: 1
3: 28
4: 238
Right 1057143908 9:92745820-92745842 GATCCAGAAGTGGCTGGGCCTGG No data
1057143901_1057143908 19 Left 1057143901 9:92745778-92745800 CCCCAAGAGGGTCTGAAGAGAAA 0: 1
1: 0
2: 0
3: 15
4: 235
Right 1057143908 9:92745820-92745842 GATCCAGAAGTGGCTGGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057143908 Original CRISPR GATCCAGAAGTGGCTGGGCC TGG Intronic
No off target data available for this crispr