ID: 1057144357

View in Genome Browser
Species Human (GRCh38)
Location 9:92748329-92748351
Sequence TCATTGCAGTTTACACCCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 43
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 42}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057144357_1057144362 11 Left 1057144357 9:92748329-92748351 CCCCCGGGTGTAAACTGCAATGA 0: 1
1: 0
2: 0
3: 0
4: 42
Right 1057144362 9:92748363-92748385 TCCCACACTCATCTTTCCCCTGG No data
1057144357_1057144366 22 Left 1057144357 9:92748329-92748351 CCCCCGGGTGTAAACTGCAATGA 0: 1
1: 0
2: 0
3: 0
4: 42
Right 1057144366 9:92748374-92748396 TCTTTCCCCTGGGATCATTCTGG No data
1057144357_1057144364 12 Left 1057144357 9:92748329-92748351 CCCCCGGGTGTAAACTGCAATGA 0: 1
1: 0
2: 0
3: 0
4: 42
Right 1057144364 9:92748364-92748386 CCCACACTCATCTTTCCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057144357 Original CRISPR TCATTGCAGTTTACACCCGG GGG (reversed) Intronic
905812975 1:40926544-40926566 TTATTGCACATTGCACCCGGGGG - Intergenic
908437571 1:64121473-64121495 TCATGGCAGTTTACATTCCGGGG - Intronic
917959879 1:180133606-180133628 TCTTTGCAGTTCACAGTCGGGGG + Intergenic
1065126155 10:22576411-22576433 TCCTTGGAGTTAACACCCGCTGG - Intronic
1070524689 10:77285620-77285642 TCATTTCAGTTTACTACCTGGGG - Intronic
1071425389 10:85544329-85544351 TCCTTGCAGTTCACACAAGGGGG - Intergenic
1072687494 10:97547112-97547134 TCGTGGCAGTTGACACCCAGTGG + Intronic
1093778714 12:23108695-23108717 TCATTGCAAGTGAAACCCGGAGG + Intergenic
1098878054 12:75887611-75887633 TCATTGGATTTTACATCTGGAGG - Intergenic
1104570009 12:129917055-129917077 TCATTGCAGTGTACACGAGCTGG + Intergenic
1110161769 13:72387086-72387108 TGACTGCAGTTTAAACCTGGAGG - Intergenic
1111468716 13:88648450-88648472 TCAAGGCAGTTGTCACCCGGGGG + Intergenic
1133719815 16:8484319-8484341 TCATTGCAAGTTAGACGCGGGGG + Intergenic
1139680017 16:68554194-68554216 TCATTGCAGTTTCCACCTCCCGG + Intronic
1140615257 16:76655548-76655570 TCATTTCAGGTGACACCAGGTGG + Intergenic
1143930760 17:10421170-10421192 TCATGGTATTTAACACCCGGTGG + Intronic
1144655734 17:17035091-17035113 TCATTGCAGTTAACCCTGGGAGG - Intergenic
1150985026 17:70186118-70186140 CCATTGCAGTGTTCACCTGGGGG + Intergenic
1151417006 17:73973106-73973128 TCATTGCAGTAGACACCTCGTGG - Intergenic
1155061786 18:22235287-22235309 CCCATGCAGTTTACACCCCGTGG + Intergenic
1155178751 18:23324801-23324823 GCATTACAGTTTACACTCAGTGG - Intronic
1155203972 18:23541459-23541481 TCACTTCTGTTTACAGCCGGGGG + Intronic
1158925766 18:62257597-62257619 TCCTTGCAGTTCACACTAGGAGG - Intronic
945917599 2:215720414-215720436 TAACAGCAGTGTACACCCGGTGG - Intergenic
946907233 2:224429094-224429116 TCATTCCAGTTCACAGCCAGCGG + Intergenic
1172524056 20:35586922-35586944 ACATTGCAGCTGACACCCAGAGG - Intergenic
1179406830 21:41133017-41133039 TCATTGGAATTTACTCCCCGCGG - Intergenic
1182803509 22:33051459-33051481 TCATTTCAGTTTACATCTTGAGG + Intronic
965210787 3:165784919-165784941 TCATCGTTATTTACACCCGGAGG + Intronic
977320231 4:95504844-95504866 TCATTGCAGTTTAAATTTGGGGG + Intronic
985548715 5:522773-522795 CCTTTTCAGTTTACACCAGGGGG + Intronic
987093208 5:14525589-14525611 CCCTTGCACTTCACACCCGGAGG + Intronic
1005563739 6:27068148-27068170 TCATTGCAGCTTAGACCTGCTGG + Intergenic
1010685936 6:78855504-78855526 TACTTGCAGTTTAAACCTGGTGG + Intergenic
1011561398 6:88620683-88620705 TCATTGCAGTTTGCAAGCTGTGG - Intronic
1025088616 7:56043751-56043773 TCACTGCAGCTTCCACCCTGGGG - Intronic
1030757766 7:113309733-113309755 TCATTGAATTTTACAGCTGGAGG - Intergenic
1041648811 8:60281281-60281303 ACACTGCGGTTCACACCCGGAGG - Exonic
1042859997 8:73302608-73302630 TCATTGCAGTCTACAACCCCTGG - Intronic
1044298938 8:90561371-90561393 TCATTTTAGTTTACAGCAGGAGG + Intergenic
1051426092 9:16932903-16932925 TCACTGCAGTTTACACCTCCTGG - Intergenic
1057144357 9:92748329-92748351 TCATTGCAGTTTACACCCGGGGG - Intronic
1061156741 9:128867252-128867274 TCATTGCAGCTTACACCTCTGGG + Intronic