ID: 1057144423

View in Genome Browser
Species Human (GRCh38)
Location 9:92748660-92748682
Sequence CATCCATCCCCAGCTGGGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057144409_1057144423 10 Left 1057144409 9:92748627-92748649 CCCTACCTCACCATCCCCTCAGC 0: 1
1: 0
2: 2
3: 58
4: 448
Right 1057144423 9:92748660-92748682 CATCCATCCCCAGCTGGGTGGGG No data
1057144414_1057144423 -5 Left 1057144414 9:92748642-92748664 CCCTCAGCCAGCTCTTCCCATCC 0: 1
1: 0
2: 3
3: 41
4: 453
Right 1057144423 9:92748660-92748682 CATCCATCCCCAGCTGGGTGGGG No data
1057144411_1057144423 5 Left 1057144411 9:92748632-92748654 CCTCACCATCCCCTCAGCCAGCT 0: 1
1: 0
2: 8
3: 63
4: 549
Right 1057144423 9:92748660-92748682 CATCCATCCCCAGCTGGGTGGGG No data
1057144412_1057144423 0 Left 1057144412 9:92748637-92748659 CCATCCCCTCAGCCAGCTCTTCC 0: 1
1: 1
2: 11
3: 92
4: 801
Right 1057144423 9:92748660-92748682 CATCCATCCCCAGCTGGGTGGGG No data
1057144410_1057144423 9 Left 1057144410 9:92748628-92748650 CCTACCTCACCATCCCCTCAGCC 0: 1
1: 0
2: 4
3: 84
4: 828
Right 1057144423 9:92748660-92748682 CATCCATCCCCAGCTGGGTGGGG No data
1057144413_1057144423 -4 Left 1057144413 9:92748641-92748663 CCCCTCAGCCAGCTCTTCCCATC 0: 1
1: 0
2: 1
3: 36
4: 417
Right 1057144423 9:92748660-92748682 CATCCATCCCCAGCTGGGTGGGG No data
1057144415_1057144423 -6 Left 1057144415 9:92748643-92748665 CCTCAGCCAGCTCTTCCCATCCA 0: 1
1: 0
2: 4
3: 50
4: 491
Right 1057144423 9:92748660-92748682 CATCCATCCCCAGCTGGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057144423 Original CRISPR CATCCATCCCCAGCTGGGTG GGG Intronic
No off target data available for this crispr