ID: 1057149141

View in Genome Browser
Species Human (GRCh38)
Location 9:92780810-92780832
Sequence TGGGATCCTGAAAATTGAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057149135_1057149141 21 Left 1057149135 9:92780766-92780788 CCATGGTGTCTGATGCTAAAGTG No data
Right 1057149141 9:92780810-92780832 TGGGATCCTGAAAATTGAGATGG No data
1057149134_1057149141 24 Left 1057149134 9:92780763-92780785 CCTCCATGGTGTCTGATGCTAAA No data
Right 1057149141 9:92780810-92780832 TGGGATCCTGAAAATTGAGATGG No data
1057149133_1057149141 29 Left 1057149133 9:92780758-92780780 CCAATCCTCCATGGTGTCTGATG No data
Right 1057149141 9:92780810-92780832 TGGGATCCTGAAAATTGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057149141 Original CRISPR TGGGATCCTGAAAATTGAGA TGG Intergenic
No off target data available for this crispr