ID: 1057160387

View in Genome Browser
Species Human (GRCh38)
Location 9:92884662-92884684
Sequence AGGGCTGGGATGCGACCTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057160375_1057160387 0 Left 1057160375 9:92884639-92884661 CCCTTCCCTGCATCCTTCCTACC No data
Right 1057160387 9:92884662-92884684 AGGGCTGGGATGCGACCTCAGGG No data
1057160379_1057160387 -5 Left 1057160379 9:92884644-92884666 CCCTGCATCCTTCCTACCAGGGC No data
Right 1057160387 9:92884662-92884684 AGGGCTGGGATGCGACCTCAGGG No data
1057160380_1057160387 -6 Left 1057160380 9:92884645-92884667 CCTGCATCCTTCCTACCAGGGCT No data
Right 1057160387 9:92884662-92884684 AGGGCTGGGATGCGACCTCAGGG No data
1057160374_1057160387 1 Left 1057160374 9:92884638-92884660 CCCCTTCCCTGCATCCTTCCTAC No data
Right 1057160387 9:92884662-92884684 AGGGCTGGGATGCGACCTCAGGG No data
1057160376_1057160387 -1 Left 1057160376 9:92884640-92884662 CCTTCCCTGCATCCTTCCTACCA No data
Right 1057160387 9:92884662-92884684 AGGGCTGGGATGCGACCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057160387 Original CRISPR AGGGCTGGGATGCGACCTCA GGG Intergenic
No off target data available for this crispr