ID: 1057160869

View in Genome Browser
Species Human (GRCh38)
Location 9:92887257-92887279
Sequence CAGCTGGACAGGAGGGCAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057160855_1057160869 27 Left 1057160855 9:92887207-92887229 CCCACGAAGGATCCCATCTTGGA 0: 1
1: 0
2: 2
3: 6
4: 61
Right 1057160869 9:92887257-92887279 CAGCTGGACAGGAGGGCAGGTGG No data
1057160863_1057160869 -8 Left 1057160863 9:92887242-92887264 CCTTGAAGGCTCCTACAGCTGGA No data
Right 1057160869 9:92887257-92887279 CAGCTGGACAGGAGGGCAGGTGG No data
1057160860_1057160869 14 Left 1057160860 9:92887220-92887242 CCATCTTGGAATGATCATGGGTC No data
Right 1057160869 9:92887257-92887279 CAGCTGGACAGGAGGGCAGGTGG No data
1057160853_1057160869 28 Left 1057160853 9:92887206-92887228 CCCCACGAAGGATCCCATCTTGG 0: 1
1: 0
2: 1
3: 11
4: 79
Right 1057160869 9:92887257-92887279 CAGCTGGACAGGAGGGCAGGTGG No data
1057160859_1057160869 15 Left 1057160859 9:92887219-92887241 CCCATCTTGGAATGATCATGGGT No data
Right 1057160869 9:92887257-92887279 CAGCTGGACAGGAGGGCAGGTGG No data
1057160856_1057160869 26 Left 1057160856 9:92887208-92887230 CCACGAAGGATCCCATCTTGGAA 0: 1
1: 0
2: 7
3: 10
4: 85
Right 1057160869 9:92887257-92887279 CAGCTGGACAGGAGGGCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057160869 Original CRISPR CAGCTGGACAGGAGGGCAGG TGG Intergenic
No off target data available for this crispr