ID: 1057162149

View in Genome Browser
Species Human (GRCh38)
Location 9:92896338-92896360
Sequence CCTTCCCTACAGATGGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057162142_1057162149 -2 Left 1057162142 9:92896317-92896339 CCTCCAGGGTGCCCTGACTCACC 0: 6
1: 9
2: 14
3: 37
4: 315
Right 1057162149 9:92896338-92896360 CCTTCCCTACAGATGGAGGCAGG No data
1057162137_1057162149 12 Left 1057162137 9:92896303-92896325 CCCTTTCCAGCAACCCTCCAGGG No data
Right 1057162149 9:92896338-92896360 CCTTCCCTACAGATGGAGGCAGG No data
1057162141_1057162149 -1 Left 1057162141 9:92896316-92896338 CCCTCCAGGGTGCCCTGACTCAC 0: 6
1: 15
2: 13
3: 20
4: 269
Right 1057162149 9:92896338-92896360 CCTTCCCTACAGATGGAGGCAGG No data
1057162140_1057162149 6 Left 1057162140 9:92896309-92896331 CCAGCAACCCTCCAGGGTGCCCT No data
Right 1057162149 9:92896338-92896360 CCTTCCCTACAGATGGAGGCAGG No data
1057162143_1057162149 -5 Left 1057162143 9:92896320-92896342 CCAGGGTGCCCTGACTCACCTTC 0: 8
1: 7
2: 12
3: 27
4: 290
Right 1057162149 9:92896338-92896360 CCTTCCCTACAGATGGAGGCAGG No data
1057162139_1057162149 11 Left 1057162139 9:92896304-92896326 CCTTTCCAGCAACCCTCCAGGGT No data
Right 1057162149 9:92896338-92896360 CCTTCCCTACAGATGGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057162149 Original CRISPR CCTTCCCTACAGATGGAGGC AGG Intergenic
No off target data available for this crispr