ID: 1057162256

View in Genome Browser
Species Human (GRCh38)
Location 9:92896798-92896820
Sequence TCAGTGGTGGCCTTATTAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057162256_1057162267 20 Left 1057162256 9:92896798-92896820 CCCACTAATAAGGCCACCACTGA No data
Right 1057162267 9:92896841-92896863 CTTCCAATGACTAGGTCACCAGG 0: 15
1: 6
2: 3
3: 11
4: 84
1057162256_1057162269 30 Left 1057162256 9:92896798-92896820 CCCACTAATAAGGCCACCACTGA No data
Right 1057162269 9:92896851-92896873 CTAGGTCACCAGGTCCCCATTGG No data
1057162256_1057162266 12 Left 1057162256 9:92896798-92896820 CCCACTAATAAGGCCACCACTGA No data
Right 1057162266 9:92896833-92896855 TGACTAGGCTTCCAATGACTAGG No data
1057162256_1057162261 -3 Left 1057162256 9:92896798-92896820 CCCACTAATAAGGCCACCACTGA No data
Right 1057162261 9:92896818-92896840 TGACCAGGTCCCCACTGACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057162256 Original CRISPR TCAGTGGTGGCCTTATTAGT GGG (reversed) Intergenic
No off target data available for this crispr