ID: 1057162259

View in Genome Browser
Species Human (GRCh38)
Location 9:92896811-92896833
Sequence AGTGGGGACCTGGTCAGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057162259_1057162267 7 Left 1057162259 9:92896811-92896833 CCACCACTGACCAGGTCCCCACT No data
Right 1057162267 9:92896841-92896863 CTTCCAATGACTAGGTCACCAGG 0: 15
1: 6
2: 3
3: 11
4: 84
1057162259_1057162269 17 Left 1057162259 9:92896811-92896833 CCACCACTGACCAGGTCCCCACT No data
Right 1057162269 9:92896851-92896873 CTAGGTCACCAGGTCCCCATTGG No data
1057162259_1057162270 22 Left 1057162259 9:92896811-92896833 CCACCACTGACCAGGTCCCCACT No data
Right 1057162270 9:92896856-92896878 TCACCAGGTCCCCATTGGTGAGG No data
1057162259_1057162266 -1 Left 1057162259 9:92896811-92896833 CCACCACTGACCAGGTCCCCACT No data
Right 1057162266 9:92896833-92896855 TGACTAGGCTTCCAATGACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057162259 Original CRISPR AGTGGGGACCTGGTCAGTGG TGG (reversed) Intergenic
No off target data available for this crispr