ID: 1057162262

View in Genome Browser
Species Human (GRCh38)
Location 9:92896821-92896843
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 6, 1: 0, 2: 0, 3: 48, 4: 190}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057162262_1057162276 27 Left 1057162262 9:92896821-92896843 CCAGGTCCCCACTGACTAGGCTT 0: 6
1: 0
2: 0
3: 48
4: 190
Right 1057162276 9:92896871-92896893 TGGTGAGGCCTTCACTGAGGAGG No data
1057162262_1057162270 12 Left 1057162262 9:92896821-92896843 CCAGGTCCCCACTGACTAGGCTT 0: 6
1: 0
2: 0
3: 48
4: 190
Right 1057162270 9:92896856-92896878 TCACCAGGTCCCCATTGGTGAGG No data
1057162262_1057162269 7 Left 1057162262 9:92896821-92896843 CCAGGTCCCCACTGACTAGGCTT 0: 6
1: 0
2: 0
3: 48
4: 190
Right 1057162269 9:92896851-92896873 CTAGGTCACCAGGTCCCCATTGG No data
1057162262_1057162275 24 Left 1057162262 9:92896821-92896843 CCAGGTCCCCACTGACTAGGCTT 0: 6
1: 0
2: 0
3: 48
4: 190
Right 1057162275 9:92896868-92896890 CATTGGTGAGGCCTTCACTGAGG No data
1057162262_1057162267 -3 Left 1057162262 9:92896821-92896843 CCAGGTCCCCACTGACTAGGCTT 0: 6
1: 0
2: 0
3: 48
4: 190
Right 1057162267 9:92896841-92896863 CTTCCAATGACTAGGTCACCAGG 0: 15
1: 6
2: 3
3: 11
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057162262 Original CRISPR AAGCCTAGTCAGTGGGGACC TGG (reversed) Intergenic
901656562 1:10772995-10773017 AATCTTAGTGAGTGGGGGCCAGG - Intronic
902919654 1:19658209-19658231 AACCCTAGAAGGTGGGGACCTGG + Intronic
903302786 1:22391033-22391055 AACCCTAGACAGTGGTGACCAGG + Intergenic
904341136 1:29835691-29835713 AAGCCCATTAGGTGGGGACCAGG + Intergenic
907865891 1:58398731-58398753 CAACCTAGTAAGTGGGGAGCTGG + Intronic
909568305 1:77080240-77080262 AAGCCTTGTCAGTGGGCAGCAGG - Intergenic
911479613 1:98421941-98421963 TAGTCTACTCATTGGGGACCTGG + Intergenic
912569523 1:110611156-110611178 AAGCCTGGTCAGTGTGGAACAGG + Intronic
915401461 1:155625064-155625086 AAGCTTAACCAGTGAGGACCAGG - Intergenic
924946550 1:248850585-248850607 ACACCTAGGCAGTGGGGAGCAGG - Intronic
1067472720 10:46548272-46548294 TAGGCTAGGCAGTGGGGGCCAGG - Intergenic
1070033724 10:72701824-72701846 AAATGTAGTCAGTGGGGGCCGGG - Intronic
1070323279 10:75371082-75371104 AAGACTAGCAAATGGGGACCTGG + Intergenic
1073605742 10:104894065-104894087 AAGCCTGGTCAGTGAGTAGCTGG - Intronic
1076586341 10:131550656-131550678 AAGCCAAGGCACTGGAGACCAGG + Intergenic
1076786276 10:132751558-132751580 CGGCCTCGTCAGTGGGGAGCAGG + Intronic
1077315388 11:1917383-1917405 AAGCCCAGGGAGTGGGGAGCAGG - Intergenic
1077508775 11:2944542-2944564 AGGCCTGGTCAGTGCGGACACGG + Exonic
1077611188 11:3643888-3643910 AAATCTAGTCATTGGGGGCCGGG + Intergenic
1078482481 11:11690283-11690305 AAGAAAAGTCAGTGGGGACAGGG + Intergenic
1083961381 11:66016722-66016744 TGGCCTAGTCAGTGAGGACATGG + Intergenic
1088287185 11:108201190-108201212 TAGTCTTGTCAGAGGGGACCAGG + Intronic
1090480328 11:127062034-127062056 AAGTCTATTCACTGGGAACCAGG + Intergenic
1092523462 12:9295281-9295303 AAGCCTCGGCAGTGGAGAGCTGG + Intergenic
1092543834 12:9436618-9436640 AAGCCTCGGCAGTGGAGAGCTGG - Intergenic
1094509112 12:31085433-31085455 AAGCCTCGGCAGTGGAGAGCTGG + Intronic
1100502876 12:95191426-95191448 AAGCCTGGTCAGTGGGACACTGG + Intronic
1101997109 12:109533433-109533455 AAGCAGGGTCAGTGGGGACGGGG - Intronic
1103840308 12:123858375-123858397 AGGCCTGGGCAGTGGGCACCGGG + Intronic
1103864203 12:124038691-124038713 CAGCCTAGTAATTGGGGACCTGG - Intronic
1104154000 12:126112953-126112975 AAGCCATGTCAGTGGGCATCTGG - Intergenic
1104856025 12:131902904-131902926 TACCCTGGGCAGTGGGGACCGGG - Intronic
1105256378 13:18746138-18746160 GAACCTAATCAGTGGGGGCCTGG - Intergenic
1105265428 13:18810369-18810391 GAGCCTGGTCAGTGAGGGCCTGG - Intergenic
1105265469 13:18810550-18810572 AGGCCTCATCAGTGGGGACCTGG - Intergenic
1108934129 13:55865567-55865589 TAGTCTTGTCAGAGGGGACCAGG - Intergenic
1121735910 14:96217959-96217981 CAGGCTCGTAAGTGGGGACCTGG - Intronic
1122075293 14:99231578-99231600 AAGACTGGTCAGTCGGGCCCTGG + Intronic
1122447373 14:101779975-101779997 AAGGCTGGGCAATGGGGACCTGG - Intronic
1122956754 14:105074799-105074821 AAGGATGGTCAGTGGAGACCAGG - Intergenic
1202833029 14_GL000009v2_random:57553-57575 CAGCCTCCTCAGTGGGGACCTGG + Intergenic
1128410063 15:67387620-67387642 CAGCCTAGTCAGGGTGGGCCAGG + Intronic
1129698676 15:77755121-77755143 AAGCGAACTGAGTGGGGACCTGG - Intronic
1130949581 15:88574798-88574820 AAGCCTAATTAGTGTGAACCGGG - Intergenic
1132243865 15:100279749-100279771 AAGCCTAGTCAGGTGGAATCTGG - Intronic
1133185012 16:4089832-4089854 AAGCCTGGCCACAGGGGACCAGG + Intronic
1135359008 16:21795222-21795244 CAGCCCACTAAGTGGGGACCTGG + Intergenic
1135457562 16:22611659-22611681 CAGCCCACTAAGTGGGGACCTGG + Intergenic
1137002993 16:35247468-35247490 AAGGCTGGTCAGTGGGGCACTGG + Intergenic
1138114140 16:54346920-54346942 AGTCCCAGTCACTGGGGACCTGG + Intergenic
1143759107 17:9088321-9088343 ATCCCTAGTAAGTGGGGATCAGG + Intronic
1144431773 17:15198878-15198900 AAGACTAGGCAGTTTGGACCAGG + Intergenic
1144493137 17:15731622-15731644 AGGCCTGGTCAGTGGGGGCCTGG + Intergenic
1144493453 17:15733114-15733136 AAAACTGGTCAGTGGGGACATGG + Intronic
1144640778 17:16935426-16935448 GGGCCTAGTTAGTGGGGTCCTGG - Intronic
1144640807 17:16935530-16935552 GAGCCTGGTCAGTCAGGACCTGG - Intronic
1144906809 17:18643538-18643560 AAAACTGGTCAGTGGGGACATGG - Intronic
1144907118 17:18645030-18645052 AGGCCTGGTCAGTGGGGGCCTGG - Intronic
1146726368 17:35159577-35159599 AAGCCTTTTAAGTGGGCACCAGG + Intronic
1147961601 17:44170923-44170945 AGGCCTAGTGAGTCGGGCCCGGG - Exonic
1148049519 17:44762553-44762575 AAGCCTAGCCGGTGTGGAGCTGG + Intronic
1148829975 17:50425283-50425305 AGGCCGAGGCAGTGTGGACCTGG + Intergenic
1150005248 17:61465070-61465092 AAGGCTTATCAGTGGGGTCCAGG + Intronic
1154422927 18:14250976-14250998 AGGCCTCATCAGTGGGGACCTGG + Intergenic
1154422970 18:14251156-14251178 GAGCCTGGTCAGTGAGGGCCTGG + Intergenic
1154434660 18:14334543-14334565 GAACCTAATCAGTGGGGGCCTGG + Intergenic
1154434715 18:14334818-14334840 AGGCCTTGTCAGTAAGGACCTGG + Intergenic
1159969835 18:74635724-74635746 AAGCCAAGTCAGTGAGGACATGG + Intronic
1161070534 19:2257758-2257780 AAGCGGAGGGAGTGGGGACCAGG - Intronic
1161102706 19:2429192-2429214 AAGCCCAGCCAGTCGGGTCCGGG + Exonic
1161133828 19:2608073-2608095 AAGCCAAGTCAGTGGGAAGGTGG + Intronic
1163232403 19:16013623-16013645 GGGCCTACTCAGTGGGGCCCTGG + Intergenic
1163233001 19:16016447-16016469 AAGCCTGGCCAGTGGGATCCTGG + Intergenic
1163236085 19:16031484-16031506 GGGCCTGGTCAGTGGGAACCTGG + Intergenic
1163236099 19:16031533-16031555 TGGTCTGGTCAGTGGGGACCTGG + Intergenic
1163236293 19:16032407-16032429 GGGCCCAGTCAGTGGGGACCTGG + Intergenic
1163236331 19:16032569-16032591 AGCTCTAGTCAGTGGGGACCTGG + Intergenic
1163236346 19:16032641-16032663 AGGACTGGTCAGTGGGGACTTGG + Intergenic
1163236423 19:16032934-16032956 GAGCCTGGTCAGTGGGGCCTAGG + Intergenic
1163236607 19:16033806-16033828 AGGCCTGGTCATTGGGGTCCTGG + Intergenic
1163236618 19:16033865-16033887 AGGCCTAGTTAGTGGGGTCCAGG + Intergenic
1163863231 19:19753315-19753337 AGGCCTAGTTAGTGGAGTCCGGG - Intergenic
1163863335 19:19753864-19753886 GGACCTGGTCAGTGGGGACCTGG - Intergenic
1163863344 19:19753909-19753931 ATGTCTGGTCAGTGGGGTCCTGG - Intergenic
1163863404 19:19754165-19754187 AGGCCTGGTCAGTGTGGACCTGG - Intergenic
1163863768 19:19755837-19755859 GGACCTGGTCAGTGGGGACCTGG - Intergenic
1163863830 19:19756085-19756107 GTGCCTGGTCAGTGAGGACCCGG - Intergenic
1165316667 19:35060279-35060301 AAGCCTGGGCTCTGGGGACCTGG + Intronic
1166010528 19:39937657-39937679 AAGACTAGTCAGAGGGGCCCAGG - Intergenic
1166232334 19:41432201-41432223 AAGCCACGTGAGTGGGGACAGGG + Exonic
1202639644 1_KI270706v1_random:70157-70179 AGGCCTCATCAGTGGGGACCTGG - Intergenic
927365782 2:22294941-22294963 AAGACTAGTAAGTGAGGAGCTGG + Intergenic
930121999 2:47768117-47768139 CAGCCCAAGCAGTGGGGACCCGG + Intronic
931056720 2:58480713-58480735 AAGCCTAGTAAGGGTGGAGCAGG + Intergenic
933500235 2:83101945-83101967 AACCCTAGTCACTGGGTTCCAGG + Intergenic
934491413 2:94763943-94763965 GAACCTAATCAGTGGGGGCCTGG - Intergenic
934495030 2:94789152-94789174 AGGCCTCATCAGTGGGAACCTGG - Intergenic
934495040 2:94789211-94789233 AGACATAGTCAGTGGGGACTTGG - Intergenic
934495057 2:94789298-94789320 GAACCTGGTCAGTGGGGACCAGG - Intergenic
934495084 2:94789418-94789440 GAGCCTGGTCAGTGAGGGCCTGG - Intergenic
934495112 2:94789558-94789580 AAGCCTGGTCCATGGGGACCTGG - Intergenic
934495121 2:94789596-94789618 AGGCCTCATCAGTGGGGACCTGG - Intergenic
934495131 2:94789641-94789663 GGACCTAGTCAGTTGGGACCTGG - Intergenic
934928046 2:98395935-98395957 AAGCCAGGTCGGTGGGGACCAGG - Exonic
935333049 2:101991305-101991327 AAGCCGAGTCAGGGTGCACCCGG - Intergenic
938279240 2:130052685-130052707 AGGCCTGGTCAGTAAGGACCTGG - Intergenic
938279259 2:130052815-130052837 AGGCCTTGTCAGTAAGGACCTGG - Intergenic
938279265 2:130052844-130052866 AGGCCTTGTCAGTAAGGACCTGG - Intergenic
938279271 2:130052873-130052895 AGGCCTTGTCAGTAAGGACCTGG - Intergenic
938279329 2:130053176-130053198 AGGCCTTGTCAGTAAGGACCTGG - Intergenic
938307481 2:130265458-130265480 CAGTCTGGTCACTGGGGACCTGG + Intergenic
938330225 2:130443561-130443583 AGGCCTGGTCAGTAAGGACCTGG - Intergenic
938330259 2:130443778-130443800 AGGCCTTGTCAGTAAGGACCTGG - Intergenic
938359686 2:130677725-130677747 AGGCCTTGTCAGTAAGGACCTGG + Intergenic
938359720 2:130677942-130677964 AGGCCTGGTCAGTAAGGACCTGG + Intergenic
938436064 2:131284259-131284281 AGGCCTTGTCAGTAAGGACCTGG + Intronic
938447851 2:131391384-131391406 CAGTCTGGTCACTGGGGACCTGG - Intergenic
938615096 2:132989425-132989447 AAGACAAAGCAGTGGGGACCCGG + Intronic
941385641 2:164847980-164848002 AAGCCAAATCAGTGGCTACCTGG - Intergenic
944474265 2:200087764-200087786 AAGCCTTATCAGAGGGCACCAGG + Intergenic
945020363 2:205564888-205564910 AAGCCTAGACAGAAGTGACCAGG + Intronic
947612602 2:231533109-231533131 AAGCCTAGTGATGGGGGTCCTGG - Intergenic
1171883072 20:30632129-30632151 AGGCCTTGTCAGTAAGGACCTGG - Intergenic
1171883126 20:30632404-30632426 AAACCTAATCAGTGGGGGCCTGG - Intergenic
1171886311 20:30654512-30654534 AGGCCTCATCAGTGGGGACCTGG - Intergenic
1174771815 20:53307365-53307387 AAGCCCATCCAATGGGGACCAGG - Intronic
1176647933 21:9367576-9367598 GAGCCTGGTCAGTGAGGGCCTGG - Intergenic
1176647971 21:9367756-9367778 AGGCCTCATCAGTGGGGACCTGG - Intergenic
1176842317 21:13850888-13850910 AGGCCTTGTCAGTAAGGACCTGG - Intergenic
1176842370 21:13851163-13851185 GAACCTAATCAGTGGGGGCCTGG - Intergenic
1176850491 21:13908792-13908814 GAGCCTGGTCAGTGAGGGCCTGG - Intergenic
1177147904 21:17426113-17426135 TAGCACTGTCAGTGGGGACCTGG + Intergenic
1177615731 21:23516366-23516388 AAGCCAACTCAGTGGGGACTTGG - Intergenic
1179418678 21:41218468-41218490 AAACCTAGCCATTGGGGAGCTGG + Intronic
1180362298 22:11911713-11911735 AGGCCTCATCAGTGGGGACCTGG + Intergenic
1180362335 22:11911893-11911915 GAGCCTGGTCAGTGAGGGCCTGG + Intergenic
1180362376 22:11912077-11912099 AAGCCTATTAAGTGTGGGCCTGG + Intergenic
1180363237 22:11918286-11918308 AAGCCAAGACAGTGGGAAACCGG + Intergenic
1181014979 22:20063620-20063642 AAGCCCAGCCTGTGGGGCCCCGG - Intronic
1181967743 22:26668559-26668581 AAGTGTGGTCAGTGGGGACTTGG - Intergenic
1183416581 22:37686134-37686156 AGTCCTAGGCAGTGGGGTCCAGG + Intronic
1184037496 22:41925700-41925722 AGGCCTGGCCAGTGGGGAGCTGG + Intronic
1184669097 22:46003499-46003521 AAGCCTAGACAGAGGGGAGCAGG - Intergenic
1184696577 22:46142813-46142835 AAGCATAAGCAGTGGGCACCTGG - Intergenic
1185407320 22:50660492-50660514 AATCTTAGTCTGTGGGAACCTGG - Intergenic
951696947 3:25454968-25454990 AAGCTTCGTCAGTGGGAACTCGG + Intronic
953620298 3:44527087-44527109 AAGCATCGTTAGTGGGAACCGGG + Intergenic
956821390 3:72957424-72957446 AAGCCTAGTCAATAGCAACCCGG - Intronic
959905850 3:111710540-111710562 AATCCTAGTTAGTGAGAACCAGG + Intronic
961677118 3:128574385-128574407 ATGTCCAGTCAGTGGGGAACTGG - Intronic
1202738914 3_GL000221v1_random:37231-37253 AGGCCTCATCAGTGGGGACCTGG + Intergenic
1202738952 3_GL000221v1_random:37411-37433 GAGCCTGGTCAGTGAGGGCCTGG + Intergenic
968492624 4:898361-898383 AGGCCTAGGCAGAGGGGCCCTGG + Intronic
971556025 4:28013898-28013920 TAGCCTCGTCTGTGGGAACCTGG - Intergenic
973366788 4:49214720-49214742 AAACCTAATCAGTGGGGGCCTGG - Intergenic
973369826 4:49236204-49236226 CGGTCTTGTCAGTGGGGACCAGG - Intergenic
973369893 4:49236510-49236532 AGGCCTCATCAGTGGGGACCTGG - Intergenic
973391139 4:49558902-49558924 AGGCCTCATCAGTGGGGACCTGG + Intergenic
973391206 4:49559208-49559230 CGGTCTTGTCAGTGGGGACCAGG + Intergenic
975426405 4:74233269-74233291 AAGCCTAGTGTGTGGGGAAGGGG + Intronic
975812655 4:78185036-78185058 AGGCCTAGTAAGTGGTGCCCTGG + Intronic
977069599 4:92367923-92367945 ACTCCTGGTCAGTGGGGTCCAGG - Intronic
978280321 4:107004143-107004165 AAGCAGAGTCAGTGAGGAACTGG + Intronic
978491623 4:109316748-109316770 TAGTCTTGTCAGAGGGGACCAGG + Intergenic
979136366 4:117116709-117116731 TAGTCTTGTCAGAGGGGACCAGG - Intergenic
1202766963 4_GL000008v2_random:155832-155854 GAGCCTGGTCAGTGAGGGCCTGG - Intergenic
1202767001 4_GL000008v2_random:156012-156034 AGGCCTCATCAATGGGGACCTGG - Intergenic
998147875 5:139740526-139740548 ACGGCTCGTCAGTGGGGAGCGGG + Intergenic
998351659 5:141505837-141505859 CAGCCTAGAAAGTGGGGACAGGG + Intronic
1001359819 5:171071470-171071492 AAGTCAAGCCAGTGGGGTCCTGG + Intronic
1008427896 6:51380629-51380651 AAGCATAGTCTGTGGGGAAGGGG + Intergenic
1015867824 6:137745136-137745158 AAACCTTGTCAGTGGGTAGCAGG + Intergenic
1017621919 6:156307826-156307848 GAGGTTATTCAGTGGGGACCAGG + Intergenic
1019330483 7:458360-458382 AAGCCCAGACAGTGGGGGCAGGG + Intergenic
1020019456 7:4854197-4854219 AAGCCTGGTCCCTGGTGACCAGG + Intronic
1022985767 7:35651906-35651928 AAGCCTGTTCAGTGGTCACCAGG - Intronic
1025966918 7:66281963-66281985 AAGCCTGGGCAGTTGGGACTGGG + Intronic
1031387109 7:121164520-121164542 AAACCTACTGAGTGGGAACCTGG - Intronic
1035113558 7:156504805-156504827 AAGCTGAGTCAGTGGGGACGAGG - Intergenic
1040101570 8:43511388-43511410 AAGACTGGTTAGTGGTGACCTGG + Intergenic
1040104828 8:43535678-43535700 AGGCCTTGTCAGTAAGGACCTGG + Intergenic
1051974784 9:22936200-22936222 CTGGCTACTCAGTGGGGACCTGG + Intergenic
1052674705 9:31605432-31605454 AAGGCTAGTCAGTGGTTGCCTGG - Intergenic
1052876797 9:33573898-33573920 AAGCCTAGTCAGTGGGGACCTGG + Intergenic
1052876851 9:33574158-33574180 GAACCCAGTCAGTGGGGACCAGG + Intergenic
1052880435 9:33598389-33598411 AGGCCTAGTCAGTAAGGACCTGG + Intergenic
1053499160 9:38570228-38570250 GAACCCAGTCAGTGGGGACCAGG - Intronic
1053499209 9:38570488-38570510 AAGCCTAGTCAGTGGGGACCTGG - Intronic
1053661988 9:40290717-40290739 GGACCTAGTCAGTTGGGACCTGG + Intronic
1053661999 9:40290762-40290784 AGGCCTCCTCAGTGGGGACCTGG + Intronic
1053662063 9:40291056-40291078 GAACCTGGTCAGTGGGGACCAGG + Intronic
1053666587 9:40321928-40321950 GAACCTAATCAGTGGGGGCCTGG + Intronic
1053666619 9:40322087-40322109 AGGCCTGGTTAGTAGGGACCTGG + Intronic
1053666647 9:40322202-40322224 AGGCCTTGTCAGTGAGGCCCTGG + Intronic
1053912438 9:42920881-42920903 GGACCTAGTCAGTTGGGACCTGG + Intergenic
1053912449 9:42920926-42920948 AGGCCTCATCAGTGGGGACCTGG + Intergenic
1053912457 9:42920964-42920986 AAGCCCAGTTCATGGGGACCTGG + Intergenic
1053912512 9:42921224-42921246 GAACCTGGTCAGTGGGGACCAGG + Intergenic
1053916173 9:42946974-42946996 GAACCTAATCAGTGGGGGCCTGG + Intergenic
1053916251 9:42947336-42947358 AATCCTTGTCAGTGGGGTCCTGG + Intergenic
1054374114 9:64436953-64436975 GGACCTAGTCAGTTGGGACCTGG + Intergenic
1054374124 9:64436998-64437020 ACGCCTCCTCAGTGGGGACCTGG + Intergenic
1054374163 9:64437176-64437198 GAGCCTCGTCAGTGAGGGCCTGG + Intergenic
1054374190 9:64437296-64437318 GAACCTGGTCAGTGGGGACCAGG + Intergenic
1054377739 9:64461956-64461978 GAACCTAATCAGTGGGGGCCTGG + Intergenic
1054377771 9:64462115-64462137 AGGCCTGGTTAGTAGGGACCTGG + Intergenic
1054377807 9:64462274-64462296 AATCCTTGTCAGTGGGGTCCTGG + Intergenic
1054517990 9:66054196-66054218 AGGCCTGGTTAGTAGGGACCTGG - Intergenic
1054518022 9:66054355-66054377 GAACCTAATCAGTGGGGGCCTGG - Intergenic
1054522547 9:66085228-66085250 GAACCTGGTCAGTGGGGACCAGG - Intergenic
1054522610 9:66085522-66085544 AGGCCTCCTCAGTGGGGACCTGG - Intergenic
1054522621 9:66085567-66085589 GGACCTAGTCAGTTGGGACCTGG - Intergenic
1055985684 9:82055479-82055501 AGGCCTTGTCAGTAAGGACCTGG + Intergenic
1056585653 9:87925643-87925665 AGGCCTTGTCAGTAAGGACCTGG - Intergenic
1056586692 9:87932051-87932073 GGGCCTTGTCAGTGGGGATCTGG - Intergenic
1056586754 9:87932292-87932314 GAGCCTGGTCAGTGAGGGCCTGG - Intergenic
1056586784 9:87932432-87932454 AAGCCTAGTCAGTGGGGACCTGG - Intergenic
1056610093 9:88120509-88120531 AAGCCTAGTCAGTGGGGACCTGG + Intergenic
1056610124 9:88120649-88120671 GAGCCTGGTCAGTGAGGGCCTGG + Intergenic
1056610184 9:88120890-88120912 GGGCCTTGTCAGTGGGGACCTGG + Intergenic
1056611226 9:88127301-88127323 AGGCCTTGTCAGTGAGGACCTGG + Intergenic
1057162165 9:92896411-92896433 ATGCCTGGTCAGTAGGAACCTGG - Intergenic
1057162262 9:92896821-92896843 AAGCCTAGTCAGTGGGGACCTGG - Intergenic
1057675438 9:97133208-97133230 AGGCCTTGTCAGTAAGGACCTGG - Intergenic
1057675443 9:97133237-97133259 AGGCCTTGTCAGTAAGGACCTGG - Intergenic
1057675454 9:97133295-97133317 AGGCCTTGTCAGTAAGGACCTGG - Intergenic
1057678579 9:97154710-97154732 GAACTCAGTCAGTGGGGACCAGG - Intergenic
1057678630 9:97154970-97154992 AAGCCTAGTCAGTGGGGACCTGG - Intergenic
1060198019 9:121635732-121635754 AAGACAAGACAGTGGGGAGCGGG + Intronic
1061484673 9:130914305-130914327 AAGCCAAGTCAGTGGATACGAGG + Intronic
1061903113 9:133683159-133683181 AAGCCTAGGCAGTGGCTGCCTGG - Intronic
1062413276 9:136435177-136435199 AAGCCAAGGCAGTGGGCACAGGG + Intronic
1203707642 Un_KI270742v1:67675-67697 AGGCCTCATCAGTGGGGACCTGG + Intergenic
1203707680 Un_KI270742v1:67855-67877 GAGCCTGGTCAGTGAGGGCCTGG + Intergenic
1203547752 Un_KI270743v1:140889-140911 AGGCCTCATCAGTGGGGACCTGG - Intergenic
1189058894 X:37730675-37730697 ATGCCTAGTCAGTGGGAGGCTGG - Exonic
1192341720 X:70268622-70268644 AGGCCTAGCCCCTGGGGACCTGG + Intronic
1193553666 X:82929146-82929168 TAGTCTTGTCAGAGGGGACCAGG + Intergenic
1193901999 X:87191636-87191658 AAACATATTCAGTGGGGACTGGG + Intergenic
1195882999 X:109612117-109612139 ATGGCTAGTTAGTGGGGAACAGG - Intergenic
1197402416 X:126007339-126007361 AAGCAGAGTCAGTGGGGATGGGG - Intergenic
1199309412 X:146305862-146305884 AAGCCAAGTCTGTGAGGACTGGG + Intergenic
1199860769 X:151798814-151798836 AAGCCTAGCCTGTGGAGACATGG + Intergenic
1200912644 Y:8544728-8544750 AGGCCTAGTTAGTGGGGATAAGG + Intergenic