ID: 1057162263

View in Genome Browser
Species Human (GRCh38)
Location 9:92896827-92896849
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 5, 1: 13, 2: 3, 3: 8, 4: 144}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057162263_1057162270 6 Left 1057162263 9:92896827-92896849 CCCCACTGACTAGGCTTCCAATG 0: 5
1: 13
2: 3
3: 8
4: 144
Right 1057162270 9:92896856-92896878 TCACCAGGTCCCCATTGGTGAGG No data
1057162263_1057162275 18 Left 1057162263 9:92896827-92896849 CCCCACTGACTAGGCTTCCAATG 0: 5
1: 13
2: 3
3: 8
4: 144
Right 1057162275 9:92896868-92896890 CATTGGTGAGGCCTTCACTGAGG No data
1057162263_1057162267 -9 Left 1057162263 9:92896827-92896849 CCCCACTGACTAGGCTTCCAATG 0: 5
1: 13
2: 3
3: 8
4: 144
Right 1057162267 9:92896841-92896863 CTTCCAATGACTAGGTCACCAGG 0: 15
1: 6
2: 3
3: 11
4: 84
1057162263_1057162276 21 Left 1057162263 9:92896827-92896849 CCCCACTGACTAGGCTTCCAATG 0: 5
1: 13
2: 3
3: 8
4: 144
Right 1057162276 9:92896871-92896893 TGGTGAGGCCTTCACTGAGGAGG No data
1057162263_1057162269 1 Left 1057162263 9:92896827-92896849 CCCCACTGACTAGGCTTCCAATG 0: 5
1: 13
2: 3
3: 8
4: 144
Right 1057162269 9:92896851-92896873 CTAGGTCACCAGGTCCCCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057162263 Original CRISPR CATTGGAAGCCTAGTCAGTG GGG (reversed) Intergenic
901822870 1:11841456-11841478 CTTTGGGTGCCTAGTCAGAGGGG - Exonic
908735118 1:67268284-67268306 CACTGGCAGGCTAGTCAGAGTGG + Intergenic
920709565 1:208282149-208282171 TATTGGATGCTTGGTCAGTGTGG + Intergenic
1069422685 10:68261023-68261045 GGTGGGAGGCCTAGTCAGTGTGG + Intergenic
1069649624 10:70036022-70036044 CAGTGGAAGCTCAGCCAGTGAGG + Intergenic
1070069813 10:73076829-73076851 CATAGGAAGACGAGTCAGAGGGG - Intronic
1071301201 10:84257301-84257323 CATTGGGAGCCCAGACAGGGTGG + Intronic
1074948526 10:118304688-118304710 CATTGCATGCTCAGTCAGTGAGG - Exonic
1076142415 10:128090392-128090414 CATTGCAAGCCTGGTTAGGGAGG + Intergenic
1076499229 10:130923223-130923245 CATCGGAAGCATAGTCAGTACGG + Intergenic
1079399761 11:20096925-20096947 CATTGGCATCATAGTAAGTGAGG + Intronic
1080060748 11:27954280-27954302 CATTGGAAGCATATTTAATGAGG - Intergenic
1084896066 11:72270008-72270030 CTTTGGAAGCCTAGAGAGAGGGG - Intergenic
1085549344 11:77353582-77353604 CAAAGGAAGCATAGTGAGTGTGG - Exonic
1089248204 11:117137735-117137757 TATAGGAACCATAGTCAGTGGGG + Intergenic
1089258507 11:117206826-117206848 TATAGGAACCATAGTCAGTGGGG - Intronic
1089499503 11:118924098-118924120 CAGTGGAAGCCCACTCACTGTGG + Intronic
1091653856 12:2330007-2330029 CACTGGAAACCCACTCAGTGTGG + Intronic
1096240071 12:49955221-49955243 CTGGGGAAGCCTTGTCAGTGCGG - Intronic
1096529223 12:52232976-52232998 CATTGGAAACGGACTCAGTGAGG - Intronic
1105256338 13:18745939-18745961 CCCTGGAGGCCTGGTCAGTGGGG - Intergenic
1105265461 13:18810518-18810540 CATTGGAAGCCTGGTCAGTGGGG - Intergenic
1105914670 13:24902059-24902081 CAGTGCCAGCCTAGGCAGTGTGG - Intronic
1107769041 13:43770134-43770156 CATTAGCTGCCTAGTCAGTGAGG + Intronic
1115185456 14:30683323-30683345 CATTGTAAGGGTAGTCACTGGGG + Intronic
1116199413 14:41771685-41771707 CATCGGAGACCTTGTCAGTGTGG + Intronic
1116503439 14:45649294-45649316 AATTGGAAGTATAGCCAGTGTGG - Intergenic
1118718957 14:68580225-68580247 CAGTGTAAGCCTTGTCAGGGAGG + Intronic
1202833038 14_GL000009v2_random:57585-57607 CATTGGAAGCCTGGTCAGTGGGG + Intergenic
1202837723 14_GL000009v2_random:90817-90839 CCCTGGAGGCCTGGTCAGTGGGG + Intergenic
1202907111 14_GL000194v1_random:80947-80969 CCCTGGAGGCCTGGTCAGTGGGG + Intergenic
1123932080 15:25176794-25176816 CACTGGATGCCTAGGCAGGGAGG + Intergenic
1124567420 15:30828871-30828893 CAGTGGCAGCCTCTTCAGTGTGG + Intergenic
1126663657 15:51056004-51056026 CATAGGAAGGCTATTCAGTATGG - Intergenic
1127215468 15:56818826-56818848 TATTGGAAGCCTAGTTTGTCAGG - Intronic
1131333013 15:91519497-91519519 CATTGGAAAATTGGTCAGTGTGG + Intergenic
1131351093 15:91700402-91700424 CAGTGCAGGTCTAGTCAGTGAGG - Intergenic
1132358271 15:101189837-101189859 CAGTGGAGGCCTGGTGAGTGGGG + Intronic
1136170548 16:28486693-28486715 CATTAGAGGCCTGGGCAGTGTGG - Intronic
1140900998 16:79367654-79367676 CACTGGAAAGGTAGTCAGTGTGG + Intergenic
1141013797 16:80428406-80428428 CATTGCAAGTCTAGTCACTTGGG + Intergenic
1144493135 17:15731616-15731638 CAGTGAAGGCCTGGTCAGTGGGG + Intergenic
1144493141 17:15731631-15731653 CAGTGGGGGCCTGGTCAGTGGGG + Intergenic
1144640779 17:16935432-16935454 CAGTGGGGGCCTAGTTAGTGGGG - Intronic
1144907114 17:18645021-18645043 CAGTGGGGGCCTGGTCAGTGGGG - Intronic
1144907120 17:18645036-18645058 CAGTGAAGGCCTGGTCAGTGGGG - Intronic
1147980289 17:44269861-44269883 CATAGGAAGCCAACCCAGTGTGG - Intergenic
1151268884 17:72978030-72978052 CATTGGATTCCTAGCCAGGGTGG + Intronic
1151666087 17:75545813-75545835 GACTGGAAGCCCAGCCAGTGGGG + Intronic
1152526170 17:80889450-80889472 CCTGGGAAGCCTGGCCAGTGTGG + Intronic
1152738876 17:82010559-82010581 CATTTGAACCCAGGTCAGTGTGG + Intronic
1154422935 18:14251008-14251030 CATTGGAAGCCTGGTCAGTGGGG + Intergenic
1154434701 18:14334742-14334764 CCCTGGAGGCCTGGTCAGTGGGG + Intergenic
1157326868 18:46675503-46675525 CATTGGAAGCATGCTCACTGTGG - Intronic
1163232353 19:16013380-16013402 CAGTGGAAACCTCGTCATTGTGG + Intergenic
1163232448 19:16013804-16013826 CATCAGAAGCCTAGTCAGTGGGG + Intergenic
1163232921 19:16016096-16016118 CATTTGGGGCCCAGTCAGTGGGG + Intergenic
1163236345 19:16032635-16032657 CACTGGAGGACTGGTCAGTGGGG + Intergenic
1163236407 19:16032871-16032893 CAGTGGGGACCTAGTCAGTGGGG + Intergenic
1163863397 19:19754141-19754163 CAGTGGAAGCCTCGGCAGTGGGG - Intergenic
1163863519 19:19754726-19754748 CAGTGGAGTCCTGGTCAGTGAGG - Intergenic
1163863612 19:19755173-19755195 CAATTGAGGCCTGGTCAGTGGGG - Intergenic
1163863718 19:19755662-19755684 CAGTGGAGGTCTGGTCAGTGGGG - Intergenic
1163863789 19:19755916-19755938 CAGTGGAAACCTGGTCAATGAGG - Intergenic
1202634924 1_KI270706v1_random:36535-36557 CCCTGGAGGCCTGGTCAGTGGGG - Intergenic
1202639635 1_KI270706v1_random:70125-70147 CATAGGAAGCCTGGTCAGTGGGG - Intergenic
930892665 2:56409316-56409338 CATTGAAGGCATAGTCAATGCGG + Intergenic
934491368 2:94763744-94763766 CCCTGGAGGCCTGGTCAGTGGGG - Intergenic
934495058 2:94789304-94789326 CAGTGGGAACCTGGTCAGTGGGG - Intergenic
934495113 2:94789564-94789586 CATTGGAAGCCTGGTCCATGGGG - Intergenic
938279346 2:130053281-130053303 CCCTGGAGGCCTGGTCAGTGGGG - Intergenic
938330296 2:130443995-130444017 CCCTGGAGGCCTGGTCAGTGGGG - Intergenic
938359649 2:130677508-130677530 CCCTGGAGGCCTGGTCAGTGGGG + Intergenic
938436046 2:131284154-131284176 CCCTGGAGGCCTGGTCAGTGGGG + Intronic
939338958 2:140868688-140868710 TATTAGAAGCATAGTGAGTGAGG + Intronic
939696056 2:145326311-145326333 CAGTGGAAGATTAGTCAGGGAGG - Intergenic
946880063 2:224168523-224168545 CACTCAAATCCTAGTCAGTGGGG + Intergenic
1170379401 20:15740468-15740490 AAATGGAAGCCTAGGAAGTGAGG + Intronic
1171881084 20:30617720-30617742 CCCTGGAGGCCTGGTCAGTGGGG - Intergenic
1171883128 20:30632410-30632432 CCGTGGAAACCTAATCAGTGGGG - Intergenic
1171886303 20:30654480-30654502 CATTGGAAGCCTGGTCAGTGGGG - Intergenic
1176626453 21:9095748-9095770 CCCTGGAGGCCTGGTCAGTGGGG + Intergenic
1176647137 21:9362303-9362325 CCCTGGAGGCCTGGTCAGTGGGG - Intergenic
1176647963 21:9367724-9367746 CACTGGAAGCCTGGTCAGTGGGG - Intergenic
1176850524 21:13908940-13908962 CATTGGAAGCCTGGTCAGTGGGG - Intergenic
1177162040 21:17558373-17558395 CTTTGGAGGCCAAGACAGTGGGG - Intronic
1179138045 21:38697880-38697902 TATCTGAAGACTAGTCAGTGAGG - Intergenic
1180362307 22:11911745-11911767 CATTGGAAGCCTGGTCAGTGGGG + Intergenic
1180365784 22:11936693-11936715 CCCTGGAGGCCTGGTCAGTGGGG + Intergenic
1180416969 22:12776599-12776621 CCCTGGAGGCCTGGTCAGTGGGG + Intergenic
1185091456 22:48777933-48777955 CTTTGGAAACCAAGTGAGTGTGG + Intronic
951015489 3:17727412-17727434 AACTGGAAGCTTAGCCAGTGTGG + Intronic
951516548 3:23566302-23566324 CATAGCAAGCCTTGCCAGTGGGG + Intronic
951994196 3:28708779-28708801 CAATGGAGGCGTAGTCAGTATGG + Intergenic
953175802 3:40551013-40551035 CATTTGAACCTTAGTCATTGTGG + Intronic
961167061 3:124770657-124770679 CTTAGGAAGCCTAGTCTGAGAGG - Intronic
962968882 3:140380651-140380673 CCATGGATGCCCAGTCAGTGAGG - Intronic
968350311 3:198047476-198047498 CCCTGGAGGCCTGGTCAGTGGGG - Intergenic
1202738922 3_GL000221v1_random:37263-37285 CATTGGAAGCCTGGTCAGTGGGG + Intergenic
1202739743 3_GL000221v1_random:42689-42711 CCCTGGAGGCCTGGTCAGTGGGG + Intergenic
969987964 4:11231295-11231317 CATTGCATGCCCAGTTAGTGTGG - Intergenic
970600720 4:17639240-17639262 CCCTGGAAGCCGAGTAAGTGAGG - Exonic
973364841 4:49200787-49200809 CCCTGGAGGCCTGGTCAGTGGGG - Intergenic
973366790 4:49214726-49214748 CCATGGAAACCTAATCAGTGGGG - Intergenic
973369885 4:49236478-49236500 CATTGGAAGCCTGGTCAGTGGGG - Intergenic
973391147 4:49558934-49558956 CATTGGAAGCCTGGTCAGTGGGG + Intergenic
973395750 4:49591663-49591685 CCCTGGAGGCCTGGTCAGTGGGG + Intergenic
974762069 4:66289959-66289981 CATTGGAATGATAGTAAGTGGGG - Intergenic
975272167 4:72448975-72448997 GGTTGGAAGCTTAGTCAATGTGG - Intronic
975375548 4:73640019-73640041 AATAGGAAGGGTAGTCAGTGGGG - Intergenic
976015589 4:80549019-80549041 CACTGTATGCATAGTCAGTGTGG + Intronic
979848022 4:125541787-125541809 CATAGGAAGCCTTAACAGTGCGG + Intergenic
982138250 4:152293453-152293475 CAGTGGAAGCCTAGGCAGAGAGG - Intergenic
1202762234 4_GL000008v2_random:122443-122465 CCCTGGAGGCCTGGTCAGTGGGG - Intergenic
1202766993 4_GL000008v2_random:155980-156002 CATTGGAAGCCTGGTCAGTGGGG - Intergenic
986140368 5:5024656-5024678 CATTGTAAGCCCCGTGAGTGTGG - Intergenic
987182682 5:15384620-15384642 CATCGGAAGCCTAATGAGTGTGG - Intergenic
996776993 5:127143304-127143326 CATTGGAACCAGGGTCAGTGGGG + Intergenic
1000353248 5:160369288-160369310 GATTGGAAGACTGGTAAGTGTGG + Intronic
1002805735 6:572519-572541 TAATGGAAGCCTCTTCAGTGAGG - Exonic
1003155053 6:3586303-3586325 CATTGGGAGCCTCGTCAGGCTGG + Intergenic
1003641534 6:7879317-7879339 CAGAGGAAGCTTAGTCTGTGGGG + Intronic
1004529926 6:16444424-16444446 CATTGGGATCCTATTCAGTTTGG - Intronic
1010951348 6:82040615-82040637 CACTGGAAACTTAGACAGTGGGG - Intergenic
1021012743 7:15492050-15492072 CAGTGGTAGCATAGTCAGGGTGG + Intronic
1029351563 7:100016270-100016292 TATTTGAAGCCTAGTCATAGTGG + Intronic
1040093837 8:43423460-43423482 CATTAGAAGGGTACTCAGTGGGG + Intergenic
1040101605 8:43511531-43511553 CAGTGGGAGCCTAGTCAGGGGGG + Intergenic
1040104710 8:43535106-43535128 CAGTGAAGGCCTACTCAGTGGGG + Intergenic
1041570833 8:59335369-59335391 AATTTGAAGACTTGTCAGTGAGG + Intergenic
1043139089 8:76565127-76565149 CACTGGAAGGCTAGTCAGAGAGG - Intergenic
1045408208 8:101888874-101888896 CACTGAAAGCTTAGACAGTGGGG + Intronic
1049528999 8:143144135-143144157 CATTGCAATCCTAGTCAGCTTGG - Intergenic
1049829552 8:144691698-144691720 CATTGCAATCCTAGTCAGCTCGG + Intergenic
1052772963 9:32706324-32706346 CTTTGGAAACCTTGTCAGTTAGG - Intergenic
1052876796 9:33573892-33573914 CATCGGAAGCCTAGTCAGTGGGG + Intergenic
1052876850 9:33574152-33574174 CAGTGGGAACCCAGTCAGTGGGG + Intergenic
1052880393 9:33598210-33598232 CAGTGGGTGCCTATTCAGTGGGG + Intergenic
1052880420 9:33598313-33598335 CCCTGGAGGCCTGGTCAGTGGGG + Intergenic
1053495558 9:38545905-38545927 CCCTGGAGGCCTGGTCAGTGGGG - Intronic
1053495583 9:38546008-38546030 CAGTGGGTGCCTATTCAGTGGGG - Intronic
1053499210 9:38570494-38570516 CATTGGAAGCCTAGTCAGTGGGG - Intronic
1053662062 9:40291050-40291072 CAGTGGGAACCTGGTCAGTGGGG + Intronic
1053912456 9:42920958-42920980 CATTGGAAGCCCAGTTCATGGGG + Intergenic
1053912511 9:42921218-42921240 CAGTGGGAACCTGGTCAGTGGGG + Intergenic
1053916250 9:42947330-42947352 CAGTGAAATCCTTGTCAGTGGGG + Intergenic
1054374189 9:64437290-64437312 CAGTGGGAACCTGGTCAGTGGGG + Intergenic
1054377806 9:64462268-64462290 CAGTGAAATCCTTGTCAGTGGGG + Intergenic
1054522548 9:66085234-66085256 CAGTGGGAACCTGGTCAGTGGGG - Intergenic
1055271308 9:74562689-74562711 CACTGGAATCCATGTCAGTGAGG + Intronic
1056020170 9:82432069-82432091 AAATGGAAGCTTAGCCAGTGGGG + Intergenic
1056463479 9:86830510-86830532 CAATGGAAGCCCAGACAGTTGGG - Intergenic
1056586693 9:87932057-87932079 CATTAGGGGCCTTGTCAGTGGGG - Intergenic
1056586726 9:87932178-87932200 CAGTGGGAACCCAGTCAGTGGGG - Intergenic
1056586785 9:87932438-87932460 CATTGGAAGCCTAGTCAGTGGGG - Intergenic
1056610092 9:88120503-88120525 CATTGGAAGCCTAGTCAGTGGGG + Intergenic
1056610152 9:88120763-88120785 CAGTGGGAACCCAGTCAGTGGGG + Intergenic
1056610183 9:88120884-88120906 CATTAGGGGCCTTGTCAGTGGGG + Intergenic
1057162206 9:92896567-92896589 CAGTGGGAACCCAGTCAGTGGGG - Intergenic
1057162263 9:92896827-92896849 CATTGGAAGCCTAGTCAGTGGGG - Intergenic
1057675481 9:97133422-97133444 CCCTGGAGGCCTGGTCAGTGGGG - Intergenic
1057678631 9:97154976-97154998 CATTGGAAGCCTAGTCAGTGGGG - Intergenic
1059763804 9:117364145-117364167 TATTGGATGCCTACTCTGTGGGG - Intronic
1060867091 9:127009221-127009243 CATTGGATGCCTCATCATTGTGG + Intronic
1203707650 Un_KI270742v1:67707-67729 CATTGGAAGCCTGGTCAGTGGGG + Intergenic
1203708388 Un_KI270742v1:72646-72668 CCCTGGAGGCCTGGTCAGTGGGG + Intergenic
1203542999 Un_KI270743v1:107324-107346 CCCTGGAGGCCTGGTCAGTGGGG - Intergenic
1203547744 Un_KI270743v1:140857-140879 CATTGGAAGCCTGGTCAGTGGGG - Intergenic
1186222124 X:7360798-7360820 CATTGGAAGCTTAGCCACAGAGG - Intergenic
1193256791 X:79357828-79357850 CATTGGAAGCTAAGTCCCTGAGG - Intergenic
1195799756 X:108694717-108694739 CATTGGAAGCCTTCTTAGTATGG - Intronic
1201162994 Y:11181177-11181199 CCCTGGAGGCCTGGTCAGTGGGG + Intergenic
1201590517 Y:15610196-15610218 GATTGGAAGCTTAGCCATTGAGG - Intergenic