ID: 1057162264

View in Genome Browser
Species Human (GRCh38)
Location 9:92896828-92896850
Sequence TCATTGGAAGCCTAGTCAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 5, 1: 12, 2: 3, 3: 7, 4: 156}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057162264_1057162270 5 Left 1057162264 9:92896828-92896850 CCCACTGACTAGGCTTCCAATGA 0: 5
1: 12
2: 3
3: 7
4: 156
Right 1057162270 9:92896856-92896878 TCACCAGGTCCCCATTGGTGAGG No data
1057162264_1057162267 -10 Left 1057162264 9:92896828-92896850 CCCACTGACTAGGCTTCCAATGA 0: 5
1: 12
2: 3
3: 7
4: 156
Right 1057162267 9:92896841-92896863 CTTCCAATGACTAGGTCACCAGG 0: 15
1: 6
2: 3
3: 11
4: 84
1057162264_1057162269 0 Left 1057162264 9:92896828-92896850 CCCACTGACTAGGCTTCCAATGA 0: 5
1: 12
2: 3
3: 7
4: 156
Right 1057162269 9:92896851-92896873 CTAGGTCACCAGGTCCCCATTGG No data
1057162264_1057162276 20 Left 1057162264 9:92896828-92896850 CCCACTGACTAGGCTTCCAATGA 0: 5
1: 12
2: 3
3: 7
4: 156
Right 1057162276 9:92896871-92896893 TGGTGAGGCCTTCACTGAGGAGG No data
1057162264_1057162275 17 Left 1057162264 9:92896828-92896850 CCCACTGACTAGGCTTCCAATGA 0: 5
1: 12
2: 3
3: 7
4: 156
Right 1057162275 9:92896868-92896890 CATTGGTGAGGCCTTCACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057162264 Original CRISPR TCATTGGAAGCCTAGTCAGT GGG (reversed) Intergenic
914769968 1:150675165-150675187 TCATTGGAAGCCAGGCCAGGTGG - Intronic
918022138 1:180704652-180704674 CCAGTGGGAGCCTATTCAGTTGG + Intronic
918456847 1:184729058-184729080 TCATTTGAGTCCTAGTCAGGAGG - Intronic
920844242 1:209580309-209580331 TCATTGGAGGCCTAGCGAGGAGG - Intergenic
1066474174 10:35728494-35728516 TATTTCTAAGCCTAGTCAGTTGG + Intergenic
1070959713 10:80490107-80490129 TTATTGGAAGGCTTGTAAGTTGG + Intronic
1073310145 10:102534534-102534556 TCATTGGAAACCTCTTCACTAGG - Intronic
1077780228 11:5319679-5319701 TCCTTTGATGCCTAGTCTGTTGG - Intronic
1088055392 11:105569991-105570013 TAATTGGAAGCAATGTCAGTAGG - Intergenic
1090089366 11:123681124-123681146 TCATTGGAAACTTACTCAGGTGG + Intergenic
1090956189 11:131514833-131514855 TCTTGGGAAGCCAAGGCAGTAGG - Intronic
1097201237 12:57280586-57280608 TCCCTGGAAGCTTAGTCAGAGGG + Intronic
1099353755 12:81607965-81607987 TCCTTTGATGCCTAGTCTGTTGG + Intronic
1100297095 12:93273383-93273405 TCATTGTTACCCTAATCAGTAGG + Intergenic
1103315301 12:120049789-120049811 AAATTGGAAGACTAGTCAGAAGG - Intronic
1105256340 13:18745940-18745962 TCCCTGGAGGCCTGGTCAGTGGG - Intergenic
1105265462 13:18810519-18810541 TCATTGGAAGCCTGGTCAGTGGG - Intergenic
1108264650 13:48694445-48694467 TTATTGCAAATCTAGTCAGTTGG - Intronic
1112342844 13:98566613-98566635 TCATGGGAAGCCTTGTCGGAAGG - Intronic
1113461601 13:110485823-110485845 TCATAGGAAGCCGGGTGAGTGGG + Exonic
1116434863 14:44885681-44885703 TCATTGGAAGCCATCTCAGAAGG + Intergenic
1119274683 14:73343572-73343594 TTATTCTAATCCTAGTCAGTGGG + Intronic
1202833037 14_GL000009v2_random:57584-57606 TCATTGGAAGCCTGGTCAGTGGG + Intergenic
1202837721 14_GL000009v2_random:90816-90838 TCCCTGGAGGCCTGGTCAGTGGG + Intergenic
1202907109 14_GL000194v1_random:80946-80968 TCCCTGGAGGCCTGGTCAGTGGG + Intergenic
1125980525 15:43996244-43996266 GACTTGGAAGCCTAGTCTGTAGG + Intronic
1136860716 16:33700213-33700235 TCTTTGGAAGCTGGGTCAGTAGG - Intergenic
1141013796 16:80428405-80428427 GCATTGCAAGTCTAGTCACTTGG + Intergenic
1142484494 17:237690-237712 TCATTGAAAGCCTTGTCACTGGG - Intronic
1144493134 17:15731615-15731637 TCAGTGAAGGCCTGGTCAGTGGG + Intergenic
1144493140 17:15731630-15731652 TCAGTGGGGGCCTGGTCAGTGGG + Intergenic
1144640780 17:16935433-16935455 TCAGTGGGGGCCTAGTTAGTGGG - Intronic
1144907115 17:18645022-18645044 TCAGTGGGGGCCTGGTCAGTGGG - Intronic
1144907121 17:18645037-18645059 TCAGTGAAGGCCTGGTCAGTGGG - Intronic
1149468945 17:56900811-56900833 TAATAGGAAGCCTAGTGAGAGGG + Intronic
1154422934 18:14251007-14251029 TCATTGGAAGCCTGGTCAGTGGG + Intergenic
1154434699 18:14334741-14334763 TCCCTGGAGGCCTGGTCAGTGGG + Intergenic
1155412289 18:25559835-25559857 TGATTGAAAGCCTAGGAAGTAGG - Intergenic
1155460527 18:26076748-26076770 TCAATGGAAGCCTCTTCATTTGG - Intronic
1157688172 18:49659807-49659829 TCATTGGAAGCTCTTTCAGTTGG + Intergenic
1163232447 19:16013803-16013825 TCATCAGAAGCCTAGTCAGTGGG + Intergenic
1163233000 19:16016440-16016462 CCATTGGAAGCCTGGCCAGTGGG + Intergenic
1163236120 19:16031613-16031635 TCAGTGGGGGCCTTGTCAGTGGG + Intergenic
1163236335 19:16032591-16032613 GCAATGGAAGCCTCATCAGTGGG + Intergenic
1163236344 19:16032634-16032656 TCACTGGAGGACTGGTCAGTGGG + Intergenic
1163236406 19:16032870-16032892 TCAGTGGGGACCTAGTCAGTGGG + Intergenic
1163236514 19:16033325-16033347 TCACTGGGGGCCTGGTCAGTAGG + Intergenic
1163236525 19:16033370-16033392 TCAGTGGGGGCCTTGTCAGTTGG + Intergenic
1163863398 19:19754142-19754164 TCAGTGGAAGCCTCGGCAGTGGG - Intergenic
1163863506 19:19754670-19754692 TCAGTGGAGACCTGGTCAGTTGG - Intergenic
1163863613 19:19755174-19755196 TCAATTGAGGCCTGGTCAGTGGG - Intergenic
1163863719 19:19755663-19755685 TCAGTGGAGGTCTGGTCAGTGGG - Intergenic
1166100180 19:40567036-40567058 TCTTTGGAAGCCTAGGCGGGAGG + Intronic
1167509322 19:49887928-49887950 TTATTGAAAGCCTGGTTAGTTGG + Intronic
1167788576 19:51656183-51656205 TCACTGGAAGCCAAGTCAAGGGG - Intergenic
1202634926 1_KI270706v1_random:36536-36558 TCCCTGGAGGCCTGGTCAGTGGG - Intergenic
1202639636 1_KI270706v1_random:70126-70148 CCATAGGAAGCCTGGTCAGTGGG - Intergenic
934491370 2:94763745-94763767 TCCCTGGAGGCCTGGTCAGTGGG - Intergenic
934495031 2:94789159-94789181 TCATTAGAGGCCTCATCAGTGGG - Intergenic
934495059 2:94789305-94789327 TCAGTGGGAACCTGGTCAGTGGG - Intergenic
934495114 2:94789565-94789587 TCATTGGAAGCCTGGTCCATGGG - Intergenic
938279348 2:130053282-130053304 TCCCTGGAGGCCTGGTCAGTGGG - Intergenic
938330298 2:130443996-130444018 TCCCTGGAGGCCTGGTCAGTGGG - Intergenic
938359647 2:130677507-130677529 TCCCTGGAGGCCTGGTCAGTGGG + Intergenic
938436044 2:131284153-131284175 TCCCTGGAGGCCTGGTCAGTGGG + Intronic
946347882 2:219125755-219125777 TCAGTGGACACCTAGTCTGTAGG - Intronic
1170033342 20:11965483-11965505 ACATTGGAATCCTAGTCTGCAGG - Intergenic
1171881086 20:30617721-30617743 TCCCTGGAGGCCTGGTCAGTGGG - Intergenic
1171883089 20:30632206-30632228 TCCCTGCAGGCCTAGTCAGTAGG - Intergenic
1171883130 20:30632411-30632433 TCCGTGGAAACCTAATCAGTGGG - Intergenic
1171886304 20:30654481-30654503 TCATTGGAAGCCTGGTCAGTGGG - Intergenic
1176626451 21:9095747-9095769 TCCCTGGAGGCCTGGTCAGTGGG + Intergenic
1176647139 21:9362304-9362326 TCCCTGGAGGCCTGGTCAGTGGG - Intergenic
1176647964 21:9367725-9367747 TCACTGGAAGCCTGGTCAGTGGG - Intergenic
1176850525 21:13908941-13908963 TCATTGGAAGCCTGGTCAGTGGG - Intergenic
1177409223 21:20708278-20708300 TCATTTGAAGAATAGTCAGAAGG - Intergenic
1178250259 21:30997045-30997067 TCATTGGGAGCCCTTTCAGTTGG - Intergenic
1180362306 22:11911744-11911766 CCATTGGAAGCCTGGTCAGTGGG + Intergenic
1180365782 22:11936692-11936714 TCCCTGGAGGCCTGGTCAGTGGG + Intergenic
1180416967 22:12776598-12776620 TCCCTGGAGGCCTGGTCAGTGGG + Intergenic
950203206 3:11059190-11059212 TCAGTGGAAACTTAGTAAGTAGG + Intergenic
950716858 3:14853843-14853865 TCATTTGGAGCCTAGTCCTTTGG + Intronic
955712866 3:61798474-61798496 TCAGAGGAAGCATAGTGAGTTGG - Intronic
957774607 3:84740546-84740568 TCAATGGAAGTCTTATCAGTGGG - Intergenic
959676540 3:109042095-109042117 TCATTAGAATCCTACTCATTAGG + Intronic
959693928 3:109229757-109229779 TCATTTCAAGCCTAGTGAGAGGG + Intergenic
963560351 3:146856801-146856823 TCACTGGCAGCCAAATCAGTAGG - Intergenic
963933240 3:151026144-151026166 TCATTGGGAGCCCTTTCAGTTGG + Intergenic
967659181 3:192084654-192084676 TCATTGGAAGCAATTTCAGTTGG + Intergenic
968350313 3:198047477-198047499 TCCCTGGAGGCCTGGTCAGTGGG - Intergenic
1202738921 3_GL000221v1_random:37262-37284 TCATTGGAAGCCTGGTCAGTGGG + Intergenic
1202739741 3_GL000221v1_random:42688-42710 TCCCTGGAGGCCTGGTCAGTGGG + Intergenic
969849395 4:9944359-9944381 TTTTTGGAATCTTAGTCAGTGGG + Intronic
970091950 4:12419546-12419568 TCATTCTAACACTAGTCAGTTGG + Intergenic
973364843 4:49200788-49200810 TCCCTGGAGGCCTGGTCAGTGGG - Intergenic
973366792 4:49214727-49214749 TCCATGGAAACCTAATCAGTGGG - Intergenic
973369886 4:49236479-49236501 TCATTGGAAGCCTGGTCAGTGGG - Intergenic
973391146 4:49558933-49558955 TCATTGGAAGCCTGGTCAGTGGG + Intergenic
973395748 4:49591662-49591684 TCCCTGGAGGCCTGGTCAGTGGG + Intergenic
974762070 4:66289960-66289982 TCATTGGAATGATAGTAAGTGGG - Intergenic
977833914 4:101625929-101625951 TCAATGGAAGGCAATTCAGTAGG - Intronic
981695785 4:147557610-147557632 TCCTTGGACACCTAGTCAGGAGG - Intergenic
982334795 4:154222334-154222356 ACTTTGGAAGCCGAGGCAGTTGG + Intergenic
1202762236 4_GL000008v2_random:122444-122466 TCCCTGGAGGCCTGGTCAGTGGG - Intergenic
1202766994 4_GL000008v2_random:155981-156003 TCATTGGAAGCCTGGTCAGTGGG - Intergenic
987694501 5:21310665-21310687 TCACAGGAAGACTGGTCAGTTGG + Intergenic
988060216 5:26157876-26157898 GCATTGGAAGCTTTTTCAGTTGG + Intergenic
988523506 5:31966752-31966774 TCCTTAGAAGCCAAGTTAGTCGG - Intronic
991745739 5:69738806-69738828 TCACAGGAAGACTGGTCAGTTGG - Intergenic
991751967 5:69816427-69816449 TCACAGGAAGACTGGTCAGTTGG + Intergenic
991797339 5:70318764-70318786 TCACAGGAAGACTGGTCAGTTGG - Intergenic
991825117 5:70614120-70614142 TCACAGGAAGACTGGTCAGTTGG - Intergenic
991831254 5:70691328-70691350 TCACAGGAAGACTGGTCAGTTGG + Intergenic
991889683 5:71318091-71318113 TCACAGGAAGACTGGTCAGTTGG - Intergenic
992449255 5:76861186-76861208 TCATTGCGTGCCTGGTCAGTTGG + Intronic
1000464560 5:161559695-161559717 TAATTGGAAACCTAATGAGTAGG + Intronic
1001924217 5:175624540-175624562 TGATTGGAAGGCTGGGCAGTTGG - Intergenic
1005556402 6:26989270-26989292 TCACAGGAAGACTGGTCAGTTGG - Intergenic
1010255358 6:73751051-73751073 TCAAAGGCAGCCTAGTGAGTTGG - Intronic
1014846735 6:126287013-126287035 ACATAGGAAGCCTAGACATTTGG - Intergenic
1014860926 6:126467517-126467539 CCATTGGAAGCTTTTTCAGTAGG - Intergenic
1021182211 7:17519876-17519898 TCCTTGGAAGCCTCATCATTAGG + Intergenic
1021362909 7:19738658-19738680 TCATTGGAAGCTATTTCAGTTGG - Intronic
1022690519 7:32647574-32647596 TCAATGGATGCATAATCAGTTGG + Intergenic
1022918072 7:34981405-34981427 TCAGTGGATGCATAATCAGTTGG + Intronic
1023259506 7:38344706-38344728 TCATAGGAAGCAGAGTGAGTGGG + Intergenic
1023259968 7:38349031-38349053 TCATAGGAAGCAGAGTGAGTGGG + Intergenic
1023260951 7:38358188-38358210 TCATAGGAAGCAGAGTGAGTGGG + Intergenic
1029504500 7:100954476-100954498 TCATTGGAAAGCTTGTCAGGAGG - Exonic
1030703495 7:112667336-112667358 TCCTTGGAAGCCTCCTCAGCAGG - Intergenic
1033976389 7:147107066-147107088 TCATAGAAAGCCTAGTCAAACGG - Intronic
1034057283 7:148048517-148048539 TCAGTGTCAGCCTAGCCAGTAGG + Intronic
1040101604 8:43511530-43511552 TCAGTGGGAGCCTAGTCAGGGGG + Intergenic
1040104709 8:43535105-43535127 TCAGTGAAGGCCTACTCAGTGGG + Intergenic
1040373963 8:46805273-46805295 ACATGGGAAGCCAAGGCAGTTGG - Intergenic
1041955733 8:63556598-63556620 TAATTGCAAGCCTAGGAAGTAGG + Intergenic
1042680473 8:71377993-71378015 TCAGAGGAAGCTGAGTCAGTAGG - Intergenic
1044622267 8:94202093-94202115 GTTGTGGAAGCCTAGTCAGTAGG - Intronic
1046089387 8:109481331-109481353 TCACTGGAAGCCTAGTAAAAAGG - Intronic
1052876795 9:33573891-33573913 TCATCGGAAGCCTAGTCAGTGGG + Intergenic
1052876849 9:33574151-33574173 TCAGTGGGAACCCAGTCAGTGGG + Intergenic
1052880418 9:33598312-33598334 TCCCTGGAGGCCTGGTCAGTGGG + Intergenic
1053418259 9:37960514-37960536 TCATTGGAACCAAAGTCAGAAGG - Intronic
1053495560 9:38545906-38545928 TCCCTGGAGGCCTGGTCAGTGGG - Intronic
1053495624 9:38546212-38546234 TCATTGGAGGCCTGGTCACATGG - Intronic
1053499211 9:38570495-38570517 TCATTGGAAGCCTAGTCAGTGGG - Intronic
1053662061 9:40291049-40291071 TCAGTGGGAACCTGGTCAGTGGG + Intronic
1053662090 9:40291195-40291217 TCATTAGAGGCCTCATCAGTGGG + Intronic
1053912455 9:42920957-42920979 TCATTGGAAGCCCAGTTCATGGG + Intergenic
1053912510 9:42921217-42921239 TCAGTGGGAACCTGGTCAGTGGG + Intergenic
1053912539 9:42921363-42921385 TCATTAGAGGCCTCATCAGTGGG + Intergenic
1053916249 9:42947329-42947351 TCAGTGAAATCCTTGTCAGTGGG + Intergenic
1054374188 9:64437289-64437311 TCAGTGGGAACCTGGTCAGTGGG + Intergenic
1054374217 9:64437435-64437457 TCATTAGAGGCCTCATCAGTGGG + Intergenic
1054377805 9:64462267-64462289 TCAGTGAAATCCTTGTCAGTGGG + Intergenic
1054522520 9:66085089-66085111 TCATTAGAGGCCTCATCAGTGGG - Intergenic
1054522549 9:66085235-66085257 TCAGTGGGAACCTGGTCAGTGGG - Intergenic
1056463480 9:86830511-86830533 TCAATGGAAGCCCAGACAGTTGG - Intergenic
1056586694 9:87932058-87932080 TCATTAGGGGCCTTGTCAGTGGG - Intergenic
1056586727 9:87932179-87932201 TCAGTGGGAACCCAGTCAGTGGG - Intergenic
1056586786 9:87932439-87932461 TCATTGGAAGCCTAGTCAGTGGG - Intergenic
1056597286 9:88018033-88018055 TTATTGGAAGTCTTGTAAGTAGG + Intergenic
1056610091 9:88120502-88120524 TCATTGGAAGCCTAGTCAGTGGG + Intergenic
1056610151 9:88120762-88120784 TCAGTGGGAACCCAGTCAGTGGG + Intergenic
1056610182 9:88120883-88120905 TCATTAGGGGCCTTGTCAGTGGG + Intergenic
1057162175 9:92896447-92896469 TCATTAGGGGCCTTGTCAGTGGG - Intergenic
1057162207 9:92896568-92896590 TCAGTGGGAACCCAGTCAGTGGG - Intergenic
1057162264 9:92896828-92896850 TCATTGGAAGCCTAGTCAGTGGG - Intergenic
1057675483 9:97133423-97133445 TCCCTGGAGGCCTGGTCAGTGGG - Intergenic
1057678632 9:97154977-97154999 TCATTGGAAGCCTAGTCAGTGGG - Intergenic
1058488377 9:105466447-105466469 TCATGGGAGGCCGAGTCAGGTGG + Intronic
1059763805 9:117364146-117364168 TTATTGGATGCCTACTCTGTGGG - Intronic
1203707649 Un_KI270742v1:67706-67728 TCATTGGAAGCCTGGTCAGTGGG + Intergenic
1203708386 Un_KI270742v1:72645-72667 TCCCTGGAGGCCTGGTCAGTGGG + Intergenic
1203543001 Un_KI270743v1:107325-107347 TCCCTGGAGGCCTGGTCAGTGGG - Intergenic
1203547745 Un_KI270743v1:140858-140880 TCATTGGAAGCCTGGTCAGTGGG - Intergenic
1186213674 X:7276531-7276553 TCAGGGGAAGTCTAGTCTGTGGG + Intronic
1191159696 X:57315729-57315751 TCCTTCGATGCCTAGTCTGTTGG - Intronic
1194320884 X:92444709-92444731 TCCTTTGATGCCTAGTCTGTTGG + Intronic
1194421959 X:93686527-93686549 TCAATGGGAGGCTAGTGAGTCGG + Intronic
1195206442 X:102604366-102604388 TCATTTGAAGCCCTATCAGTAGG - Intergenic
1200628999 Y:5557845-5557867 TCCTTTGATGCCTAGTCTGTTGG + Intronic
1201162992 Y:11181176-11181198 TCCCTGGAGGCCTGGTCAGTGGG + Intergenic