ID: 1057162269

View in Genome Browser
Species Human (GRCh38)
Location 9:92896851-92896873
Sequence CTAGGTCACCAGGTCCCCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057162259_1057162269 17 Left 1057162259 9:92896811-92896833 CCACCACTGACCAGGTCCCCACT No data
Right 1057162269 9:92896851-92896873 CTAGGTCACCAGGTCCCCATTGG No data
1057162257_1057162269 29 Left 1057162257 9:92896799-92896821 CCACTAATAAGGCCACCACTGAC No data
Right 1057162269 9:92896851-92896873 CTAGGTCACCAGGTCCCCATTGG No data
1057162262_1057162269 7 Left 1057162262 9:92896821-92896843 CCAGGTCCCCACTGACTAGGCTT 0: 6
1: 0
2: 0
3: 48
4: 190
Right 1057162269 9:92896851-92896873 CTAGGTCACCAGGTCCCCATTGG No data
1057162265_1057162269 -1 Left 1057162265 9:92896829-92896851 CCACTGACTAGGCTTCCAATGAC 0: 5
1: 10
2: 6
3: 12
4: 117
Right 1057162269 9:92896851-92896873 CTAGGTCACCAGGTCCCCATTGG No data
1057162263_1057162269 1 Left 1057162263 9:92896827-92896849 CCCCACTGACTAGGCTTCCAATG 0: 5
1: 13
2: 3
3: 8
4: 144
Right 1057162269 9:92896851-92896873 CTAGGTCACCAGGTCCCCATTGG No data
1057162264_1057162269 0 Left 1057162264 9:92896828-92896850 CCCACTGACTAGGCTTCCAATGA 0: 5
1: 12
2: 3
3: 7
4: 156
Right 1057162269 9:92896851-92896873 CTAGGTCACCAGGTCCCCATTGG No data
1057162256_1057162269 30 Left 1057162256 9:92896798-92896820 CCCACTAATAAGGCCACCACTGA No data
Right 1057162269 9:92896851-92896873 CTAGGTCACCAGGTCCCCATTGG No data
1057162260_1057162269 14 Left 1057162260 9:92896814-92896836 CCACTGACCAGGTCCCCACTGAC 0: 6
1: 25
2: 77
3: 157
4: 459
Right 1057162269 9:92896851-92896873 CTAGGTCACCAGGTCCCCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057162269 Original CRISPR CTAGGTCACCAGGTCCCCAT TGG Intergenic
No off target data available for this crispr