ID: 1057164044

View in Genome Browser
Species Human (GRCh38)
Location 9:92912717-92912739
Sequence TGCGCGCGCGTCTCACAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057164044_1057164047 0 Left 1057164044 9:92912717-92912739 CCAACTTGTGAGACGCGCGCGCA No data
Right 1057164047 9:92912740-92912762 CACGCGCACGTTTAGATGGAGGG No data
1057164044_1057164048 1 Left 1057164044 9:92912717-92912739 CCAACTTGTGAGACGCGCGCGCA No data
Right 1057164048 9:92912741-92912763 ACGCGCACGTTTAGATGGAGGGG No data
1057164044_1057164046 -1 Left 1057164044 9:92912717-92912739 CCAACTTGTGAGACGCGCGCGCA No data
Right 1057164046 9:92912739-92912761 ACACGCGCACGTTTAGATGGAGG No data
1057164044_1057164045 -4 Left 1057164044 9:92912717-92912739 CCAACTTGTGAGACGCGCGCGCA No data
Right 1057164045 9:92912736-92912758 CGCACACGCGCACGTTTAGATGG No data
1057164044_1057164049 2 Left 1057164044 9:92912717-92912739 CCAACTTGTGAGACGCGCGCGCA No data
Right 1057164049 9:92912742-92912764 CGCGCACGTTTAGATGGAGGGGG No data
1057164044_1057164050 20 Left 1057164044 9:92912717-92912739 CCAACTTGTGAGACGCGCGCGCA No data
Right 1057164050 9:92912760-92912782 GGGGGATTTCCTAGCCATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057164044 Original CRISPR TGCGCGCGCGTCTCACAAGT TGG (reversed) Intergenic