ID: 1057167624

View in Genome Browser
Species Human (GRCh38)
Location 9:92941139-92941161
Sequence GAGGGAAAACAGCAGGGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057167613_1057167624 15 Left 1057167613 9:92941101-92941123 CCAAGAGCAGGTTGGGGGTTGCC No data
Right 1057167624 9:92941139-92941161 GAGGGAAAACAGCAGGGGGAAGG No data
1057167619_1057167624 -6 Left 1057167619 9:92941122-92941144 CCGGATGGAGAATGACGGAGGGA No data
Right 1057167624 9:92941139-92941161 GAGGGAAAACAGCAGGGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057167624 Original CRISPR GAGGGAAAACAGCAGGGGGA AGG Intergenic
No off target data available for this crispr