ID: 1057169574

View in Genome Browser
Species Human (GRCh38)
Location 9:92953260-92953282
Sequence GTGTAAGTATAGACACATCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057169572_1057169574 -6 Left 1057169572 9:92953243-92953265 CCAGATGCAGCACTTTTGTGTAA 0: 1
1: 0
2: 0
3: 8
4: 85
Right 1057169574 9:92953260-92953282 GTGTAAGTATAGACACATCAGGG No data
1057169571_1057169574 18 Left 1057169571 9:92953219-92953241 CCTACAGGGTAAAAAAAAAATGC 0: 1
1: 0
2: 3
3: 94
4: 760
Right 1057169574 9:92953260-92953282 GTGTAAGTATAGACACATCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057169574 Original CRISPR GTGTAAGTATAGACACATCA GGG Intronic
No off target data available for this crispr