ID: 1057169592

View in Genome Browser
Species Human (GRCh38)
Location 9:92953513-92953535
Sequence CAGTGTGAGCAGCGAGAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 217}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057169592_1057169594 4 Left 1057169592 9:92953513-92953535 CCAGCTTCTCGCTGCTCACACTG 0: 1
1: 0
2: 1
3: 16
4: 217
Right 1057169594 9:92953540-92953562 ATTTTACACACATTTTCCCAGGG No data
1057169592_1057169593 3 Left 1057169592 9:92953513-92953535 CCAGCTTCTCGCTGCTCACACTG 0: 1
1: 0
2: 1
3: 16
4: 217
Right 1057169593 9:92953539-92953561 CATTTTACACACATTTTCCCAGG No data
1057169592_1057169602 30 Left 1057169592 9:92953513-92953535 CCAGCTTCTCGCTGCTCACACTG 0: 1
1: 0
2: 1
3: 16
4: 217
Right 1057169602 9:92953566-92953588 CCCCAGGAACTTGGTGTCCAGGG No data
1057169592_1057169600 29 Left 1057169592 9:92953513-92953535 CCAGCTTCTCGCTGCTCACACTG 0: 1
1: 0
2: 1
3: 16
4: 217
Right 1057169600 9:92953565-92953587 CCCCCAGGAACTTGGTGTCCAGG No data
1057169592_1057169595 14 Left 1057169592 9:92953513-92953535 CCAGCTTCTCGCTGCTCACACTG 0: 1
1: 0
2: 1
3: 16
4: 217
Right 1057169595 9:92953550-92953572 CATTTTCCCAGGGAGCCCCCAGG No data
1057169592_1057169598 21 Left 1057169592 9:92953513-92953535 CCAGCTTCTCGCTGCTCACACTG 0: 1
1: 0
2: 1
3: 16
4: 217
Right 1057169598 9:92953557-92953579 CCAGGGAGCCCCCAGGAACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057169592 Original CRISPR CAGTGTGAGCAGCGAGAAGC TGG (reversed) Intronic
900523266 1:3116336-3116358 CAGTGTGAGAACCGAGAGCCAGG + Intronic
900594793 1:3475856-3475878 CACTGTGGGCAGCCAGAGGCTGG + Intronic
903404265 1:23083251-23083273 CTGAGTGGGCTGCGAGAAGCGGG + Exonic
903410711 1:23140974-23140996 CAGTGTGCCCAGGGAGAAGGTGG + Intronic
904199566 1:28811263-28811285 CAGTGCGAGCAGATAGAAGGGGG - Intergenic
905397408 1:37675718-37675740 CAGTAGGACCAGAGAGAAGCTGG + Intergenic
905940238 1:41857240-41857262 CAGAGTAAACAGAGAGAAGCCGG - Intronic
906034085 1:42740159-42740181 CAGGGGGAGCAGCGAGAAGGAGG + Exonic
906877725 1:49556983-49557005 CACTCTGAGCAGCTAGCAGCCGG - Intronic
907974379 1:59416848-59416870 CACTCTTAGCAGCAAGAAGCAGG + Intronic
908007964 1:59746171-59746193 CAGTGACAGCAGTGAGATGCAGG + Intronic
910141457 1:84031470-84031492 CTGTGAAAGCAGCCAGAAGCTGG - Intergenic
910589932 1:88919445-88919467 CAGTCTGAGCAGCCTGCAGCAGG + Intergenic
910935984 1:92484914-92484936 CAGTGGAAACAGCGCGAAGCCGG - Intronic
911497766 1:98651300-98651322 CAGTGGGAGCGGGGAGAGGCTGG + Intergenic
913113192 1:115674116-115674138 CAGTGTGAGCAGAAACAGGCTGG - Intronic
915724307 1:158006972-158006994 CAGTGTAAGCAGAGAGAGGAGGG + Intronic
916411455 1:164550954-164550976 CAGTGAAAGCAGCCAGGAGCAGG - Intergenic
916890867 1:169111192-169111214 CAGGGTGAAAATCGAGAAGCTGG - Intronic
917928075 1:179805624-179805646 CAGCTTGAGCAGAGAGAAACTGG - Intronic
918464317 1:184806245-184806267 CAGTGGGAGCAGGAAGAAGTTGG + Intronic
918936034 1:190923569-190923591 CAATGTGATCAGTGAGAACCTGG + Intergenic
919145488 1:193629345-193629367 CAGTGTGAGAAAAGAGAAACAGG + Intergenic
919430057 1:197481359-197481381 CAGTGAGTGCAAAGAGAAGCAGG + Intergenic
920376701 1:205512592-205512614 GAGTGTGAGGAGGGAGAGGCGGG + Intronic
920783756 1:209020553-209020575 CAGTGAAAGCAGCCAGAAGAGGG + Intergenic
921471657 1:215557187-215557209 CAGTGGGAGCAGCTATAGGCAGG + Intergenic
922165951 1:223115982-223116004 CAGTAAGAGCAGAGAGAAGAGGG - Intronic
922449274 1:225723701-225723723 CTTTCTGTGCAGCGAGAAGCAGG + Intergenic
1064322765 10:14320899-14320921 AAGGGTGAGCTGCAAGAAGCAGG - Intronic
1065473128 10:26103449-26103471 CAGCGTGAGCAACAAGAAGATGG - Intronic
1065970039 10:30798868-30798890 CCGTTTGAGCTGGGAGAAGCGGG - Intergenic
1067828272 10:49595275-49595297 CAGTGTGAGAAGCAAGAGGCAGG - Intergenic
1068137597 10:52965779-52965801 CACTGGGAGCAGGGAGAGGCCGG + Intergenic
1068287772 10:54962269-54962291 CAGTGCCAGCAGAGAGCAGCAGG - Intronic
1075310177 10:121407251-121407273 CAGGGTGAGGCCCGAGAAGCAGG + Intergenic
1076869248 10:133185496-133185518 CAGTGTGTGCAGTGTGAAGTAGG + Intronic
1077364195 11:2154973-2154995 CAGCGTGAGCAGCCGCAAGCTGG + Intronic
1083288512 11:61676556-61676578 CACTGTGAGCAGACAGGAGCTGG - Intergenic
1083318045 11:61828323-61828345 CCGTCTGTGCAGCGAGCAGCCGG + Exonic
1083628447 11:64083878-64083900 GAGTGTGAGCAGCGTGCAGGCGG + Intronic
1084659696 11:70539635-70539657 GAGTCTGGGCAGGGAGAAGCTGG - Intronic
1085616618 11:78004909-78004931 CTGTGGCAGCAGCCAGAAGCTGG - Intergenic
1089814352 11:121159014-121159036 CACTGTGAGCACAGAGAGGCAGG + Intronic
1091597788 12:1890569-1890591 CAGTGGCAGCAGCCAGATGCAGG - Intronic
1096240424 12:49956853-49956875 CAGTGGTAGGAGCCAGAAGCAGG - Exonic
1098141724 12:67456819-67456841 CAGTGTGAGCTGCCAACAGCTGG - Intergenic
1099845046 12:88018639-88018661 CAGTGAAAGCAGCCAGGAGCAGG + Intronic
1100466439 12:94849652-94849674 CAGTGGGAGCAGCCATAGGCAGG - Intergenic
1102073627 12:110042709-110042731 CAGGGTGGGCAGCAAGAAGGGGG + Intronic
1104040526 12:125127248-125127270 CAGAGTGAGCAGCAGGAAGGAGG + Intronic
1104864304 12:131943651-131943673 CCCTGTGGGCAGCAAGAAGCTGG + Exonic
1104882752 12:132084036-132084058 CAGTGTGACCAGCGCTCAGCAGG + Intergenic
1111396100 13:87671958-87671980 CAGTGTGCGCTGCAAGAAGAAGG + Intergenic
1112962170 13:105139967-105139989 CAATGCGTGCAGCGAGAAGAGGG - Intergenic
1114366662 14:22034294-22034316 CAGTGTGAACAGGAAGAGGCAGG + Intergenic
1118015116 14:61652715-61652737 CAGTCTAAGCAGCAAGAAGTGGG - Intronic
1118284151 14:64455816-64455838 CAGTGTGAGCTGAGGGCAGCAGG - Intronic
1122786150 14:104164149-104164171 CAGTGGGGGCAGCGAGAGGCCGG + Intronic
1122857160 14:104565471-104565493 GCGTGTGAGCTGCGGGAAGCAGG + Intronic
1125102311 15:35928629-35928651 CAGTCTCTGCAGTGAGAAGCAGG + Intergenic
1125957162 15:43798486-43798508 CAGCTTGAGGAGCCAGAAGCTGG + Exonic
1126907900 15:53387079-53387101 CAGTGTGTTAAGGGAGAAGCAGG + Intergenic
1127620020 15:60724894-60724916 CAGTGTGAGGAGCGGGGAGGAGG - Intronic
1128679372 15:69636855-69636877 CAGTGTAAACAGAGAGCAGCAGG + Intergenic
1128729518 15:70011311-70011333 CAGTCTGTGCTGCAAGAAGCAGG + Intergenic
1129281731 15:74490300-74490322 CAGGGTGAGCAGCCGGAAGAGGG - Intergenic
1130045557 15:80441715-80441737 CAGTGTAGGCAGCGAAAACCTGG - Intronic
1131188700 15:90295491-90295513 CAGGGTGAGCAGGCAGGAGCAGG + Intronic
1131290374 15:91101581-91101603 CAGTGAGAGCAGAGAGGAGGAGG + Intronic
1136153727 16:28368380-28368402 CGGTGGGAGCAGCGGGAAGCCGG - Intergenic
1136209365 16:28746890-28746912 CGGTGGGAGCAGCGGGAAGCCGG + Intergenic
1137715547 16:50596107-50596129 CAGTGAGAGCAGTGAGAAGCAGG + Intronic
1140057680 16:71539635-71539657 CAGTGTGAACAGAGTGAAGAGGG + Intronic
1141846136 16:86610423-86610445 CAGTGTGATTAGCCAGAAGGTGG - Intergenic
1142192838 16:88725778-88725800 CAGCGTGGGCAGAGAGGAGCAGG - Intronic
1143775869 17:9198426-9198448 AAGTGTGAGCTGCGTGCAGCTGG + Intronic
1144266417 17:13573859-13573881 CAGAGAGAGCAGAGAGAAGGAGG - Intronic
1144800501 17:17922908-17922930 GAGTGTGAGCAGAGAGGACCAGG + Intronic
1148709898 17:49671530-49671552 CAGTGTGAGCATCAAAAAGAAGG + Intronic
1150819258 17:68421905-68421927 CAGAGTGAGCAGGGAGAGGCTGG + Exonic
1151230097 17:72678325-72678347 CCCTGTGAACAGCGAGAAGGAGG + Intronic
1153255462 18:3165958-3165980 CAGTGTGAGCACCAAGCTGCAGG - Intronic
1155036579 18:22029818-22029840 CAGTGAGAGCCGAGAGAAGGGGG + Intergenic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1160261586 18:77299271-77299293 CAGTGTGAGCAGGGCAGAGCAGG - Intergenic
1160512964 18:79462850-79462872 CAGTGTGTGCAGTTGGAAGCTGG + Intronic
1161682070 19:5685080-5685102 CAGTGTGGGCAGTGAGCACCAGG - Exonic
1163021477 19:14482971-14482993 CGGCATGAGCAGCGAGAAGTGGG + Exonic
1163112596 19:15170507-15170529 CAGTGGCAGCAGCGGGACGCTGG + Exonic
1165719574 19:38069503-38069525 CAGAGAGAGCAGAGAGAAGAGGG - Intronic
1167433044 19:49464216-49464238 CAGTGTGTGGAGCGAGAGGCTGG + Exonic
1167713413 19:51125753-51125775 GAGGGTGAGCACCGAGGAGCGGG - Exonic
925148615 2:1599811-1599833 CTGGGTGAGCAGGGAGCAGCAGG - Intergenic
927542733 2:23927176-23927198 CAGGGAGAGGAGCGAGCAGCCGG - Intergenic
928194140 2:29202160-29202182 CAGTGTGAACAGCCAGAGGCAGG - Intronic
928213471 2:29341422-29341444 CACAGTGAGTAGCGAGAGGCTGG + Intronic
929346505 2:40890526-40890548 CAGTGGCAGCAGCTATAAGCAGG - Intergenic
932079149 2:68695530-68695552 CAGTGTGAGCAGGTAAGAGCAGG - Intronic
934790627 2:97056824-97056846 CAGTTTCAGCAGCCAGGAGCAGG - Intergenic
934815833 2:97325705-97325727 CAGTTTCAGCAGCCAGGAGCAGG + Intergenic
934821862 2:97382778-97382800 CAGTTTCAGCAGCCAGGAGCAGG - Intergenic
935066505 2:99652912-99652934 CTGAGGGAGCAGCGAGAGGCAGG + Intronic
936022370 2:109004596-109004618 CACAGTGAGAAGCGAGAAGAGGG + Intergenic
937039827 2:118812722-118812744 CAGAGTGAGCAGCAAGATCCTGG - Intergenic
937204528 2:120226972-120226994 CAGTCAGAGCAGCTGGAAGCTGG + Intergenic
937547094 2:123036056-123036078 CTGTGAGAGCAGCCAGAAGGGGG - Intergenic
941110919 2:161417970-161417992 CAGACTGAGCTGCGAGAAGGGGG + Intronic
942483910 2:176419397-176419419 CAGTGTGGGAAGAGAGAAGGGGG - Intergenic
942522334 2:176817489-176817511 CAGTCTGAGGAGCAAGAGGCTGG + Intergenic
942528252 2:176879586-176879608 TAGGGTGAGCAGAGAGGAGCAGG + Intergenic
945947685 2:216010224-216010246 CATTGGGAGCAACCAGAAGCTGG + Intronic
946884363 2:224208348-224208370 CAGTGTGAGCAAGGAGAGGTTGG + Intergenic
946965377 2:225031531-225031553 AGGTGTGAGCAGGGAGAAGGAGG + Intronic
948795249 2:240399238-240399260 CAGTGTGGGCAGAGAGAGGTGGG - Intergenic
948891658 2:240909798-240909820 CAGAGTGAGCAGGGAGCAGGCGG + Intergenic
1168916333 20:1491291-1491313 CAGTGCCAGCAGCAGGAAGCAGG + Exonic
1168970394 20:1926864-1926886 CACTGTGAGCATTGAGAGGCTGG - Intronic
1169928273 20:10805763-10805785 CATTAAGAGCAGCCAGAAGCAGG - Intergenic
1170098744 20:12675455-12675477 CAGTGGGAGGAGAGACAAGCAGG + Intergenic
1174121910 20:48272128-48272150 GAGTGACAGCAGGGAGAAGCAGG - Intergenic
1174558966 20:51416415-51416437 CAGAGTGAGAAGCCAGGAGCTGG - Intronic
1175225107 20:57440039-57440061 TATTCTGAGCAGCGGGAAGCTGG - Intergenic
1175316842 20:58054679-58054701 CAGTCAGAGCAACCAGAAGCAGG + Intergenic
1176666303 21:9690506-9690528 CAGTGTCAGCAGAGATCAGCGGG - Intergenic
1179721474 21:43318689-43318711 CAGTGTGTCCAGTGAAAAGCTGG + Intergenic
1181112594 22:20610720-20610742 GAGAGTGAACAGAGAGAAGCCGG + Intergenic
1181920155 22:26314408-26314430 CAGTGTGGCCAGCAAGAAGGGGG + Intronic
1183611227 22:38907763-38907785 ACTTGTGAGCAGCGAGTAGCCGG + Intergenic
1184109454 22:42386518-42386540 GAGTGTGAGCTGGTAGAAGCTGG - Intronic
1184526940 22:45029620-45029642 CAGTGTGTCCAGAGAGCAGCAGG + Intergenic
951222263 3:20081235-20081257 CAGTGTGAACAGGCAGCAGCTGG - Intronic
956175719 3:66471469-66471491 CAGTGGGAGCAGGGAGCACCTGG - Intronic
960048842 3:113221909-113221931 CAGTGTGAGCAGCAATCAGGAGG - Intronic
960618701 3:119619211-119619233 CAGTGGGAGCATGGTGAAGCAGG - Intronic
961760436 3:129163264-129163286 CAGTGTGAGCAGAGAAAGGAAGG - Intergenic
965459765 3:168947553-168947575 CAGAGAGACCAGCTAGAAGCTGG + Intergenic
967825922 3:193877301-193877323 AAGTGGGAGGAGTGAGAAGCTGG + Intergenic
967866470 3:194194175-194194197 CAGTGAGAGAAGCCAGCAGCAGG - Intergenic
968010396 3:195270684-195270706 CAGTGAGCGCAGCGCGACGCGGG + Exonic
968506822 4:974561-974583 CAGTCTGAGGAGGGAGGAGCAGG + Intronic
968578150 4:1377439-1377461 CAGTGTGAGGAGGGAGGGGCTGG + Intronic
969066122 4:4482693-4482715 CATTCTGGGCAGAGAGAAGCAGG - Intronic
969484668 4:7465489-7465511 CACTGTGAGGAGCCAGGAGCTGG + Intronic
969672719 4:8598564-8598586 CAGTGGGAGCAGCAGGAACCCGG - Intronic
972713822 4:41625762-41625784 CAATTTGAGCAGGGAGAATCTGG - Intronic
972773544 4:42220489-42220511 CAGAGTGAGGAACCAGAAGCTGG - Intergenic
975285063 4:72607413-72607435 CTGTGAAAGCAGCCAGAAGCGGG + Intergenic
977716517 4:100189947-100189969 CAGTTTGAGCAGCAAGAACCCGG - Exonic
979215489 4:118159051-118159073 CTGTGGGAGAAGCTAGAAGCTGG - Intronic
979446598 4:120820894-120820916 CAGTGAGAGCAGTGAGAGCCGGG + Intronic
981277796 4:142922232-142922254 CAGTGAGAGAAACAAGAAGCTGG + Intergenic
981282847 4:142979421-142979443 CAGTAAGAGCAGAGTGAAGCAGG + Intergenic
983657438 4:170097863-170097885 CTGTGAAAGCAGCCAGAAGCGGG - Intergenic
985408718 4:189661830-189661852 CAGTGTCAGCAGAGATCAGCTGG + Intergenic
986333686 5:6736915-6736937 CAGTCTCAGCAGAGAGAAACAGG - Intronic
986823498 5:11495852-11495874 GAGTGGGAGCAGAGAGGAGCTGG - Intronic
989767499 5:45104219-45104241 CAGTGTAAGCAGCCAGGAGGGGG + Intergenic
990953187 5:61318779-61318801 CAGTGTGGGCAGCATTAAGCGGG + Intergenic
991183887 5:63785595-63785617 CTGTGAAAGCAGCCAGAAGCAGG + Intergenic
995359134 5:111274051-111274073 CAGTGTGAGCAGAAAGGAGTGGG - Intronic
995715675 5:115080010-115080032 CAGCGTGAGCATGGAGAACCAGG + Intergenic
1000407884 5:160907891-160907913 CAGGCTGAGCAGCTAAAAGCTGG + Intergenic
1001536708 5:172503177-172503199 CAGTGTGAGCAGAGGGATCCAGG + Intergenic
1002212341 5:177606478-177606500 CAGTGGCAACAGCGAGAAGCGGG - Intronic
1004022214 6:11786232-11786254 CAGGTTGAGCAGCGATGAGCAGG + Intronic
1004432977 6:15563071-15563093 CAGTCTGAAGAGCTAGAAGCAGG - Intronic
1006421814 6:33939215-33939237 CTGTGAGAGGAGCGAGAGGCAGG + Intergenic
1006470683 6:34227075-34227097 GAGGGTGAGCAGCGTGAATCTGG - Intergenic
1007657747 6:43462151-43462173 CAGAGTGAGCAGAGAGGAGGAGG - Intergenic
1010291053 6:74138394-74138416 CACTGTGATCATAGAGAAGCAGG - Intergenic
1012985612 6:105873208-105873230 AAGTGTGAGCAGAGATAAGTAGG + Intergenic
1013290941 6:108718164-108718186 CAGTGTGAGAAGCCAGAGGAAGG + Intergenic
1015137517 6:129890571-129890593 CAGAGTGAGCAGGGAGAGCCAGG + Intergenic
1017503526 6:155046892-155046914 CAGTGTGAGATGAGAGATGCAGG + Intronic
1017658104 6:156649136-156649158 CAGCCTGAGCAGACAGAAGCTGG + Intergenic
1018092710 6:160358836-160358858 CAGTCTGAGCAGAGGGACGCTGG + Intronic
1018663603 6:166113136-166113158 CAGTATCAGCATCGAGAACCAGG - Intergenic
1018908878 6:168090506-168090528 CAGTGAGAACAGGGAGAAGATGG - Intergenic
1020107354 7:5428265-5428287 CGGCGTGAGCAGCGGGAAGGAGG - Intergenic
1023878732 7:44306902-44306924 CGGTGTGAGCAGGGGGAAGAGGG + Intronic
1023878856 7:44307376-44307398 GGGTGTGAGCAGGGAGAAGAGGG + Intronic
1024208462 7:47183652-47183674 CAGTGGGAGTAGAGAGAAGTGGG + Intergenic
1027190496 7:75993474-75993496 CAGTGTGAGGAGAGCCAAGCAGG + Intronic
1032638625 7:133739410-133739432 CAGGGAGAGCAGTGACAAGCTGG + Intronic
1033269005 7:139913893-139913915 GAGGGTGAGCAGGGAGAGGCTGG - Intronic
1033731712 7:144187196-144187218 CAGTGGGAAGAGCGAGGAGCAGG - Exonic
1033742562 7:144285779-144285801 CAGTGGGAAGAGCGAGGAGCAGG - Intergenic
1033751341 7:144363835-144363857 CAGTGGGAAGAGCGAGGAGCAGG + Exonic
1034427387 7:151021263-151021285 CAGTTGGACCAGCCAGAAGCCGG + Exonic
1034555888 7:151850129-151850151 CAGTGTCTGCAGAAAGAAGCGGG + Intronic
1034697488 7:153066759-153066781 CACTGAGAGCAGAGAGAACCTGG + Intergenic
1034816129 7:154173580-154173602 CAGGGAGAGCAGGGAGCAGCGGG - Intronic
1035339453 7:158151144-158151166 CGGTGTGGGCAGGGAGAGGCAGG - Intronic
1035339473 7:158151217-158151239 CAGTGTGGGCAGGGAGAGGCAGG - Intronic
1035339480 7:158151254-158151276 CGGTGTGGGCAGGGAGAGGCAGG - Intronic
1035339490 7:158151291-158151313 CGGTGTGGGCAGGGAGAGGCAGG - Intronic
1035339500 7:158151327-158151349 CGGTGTGGGCAGGGAGAGGCAGG - Intronic
1035339510 7:158151364-158151386 CGGTGTGGGCAGGGAGAGGCAGG - Intronic
1035339520 7:158151401-158151423 CGGTGTGGGCAGGGAGAGGCAGG - Intronic
1035339540 7:158151475-158151497 CGGTGTGGGCAGGGAGAGGCAGG - Intronic
1039364436 8:36915632-36915654 CAGTGTGAACAGGGTGAAGGAGG - Intronic
1039884286 8:41646467-41646489 CAGGCTGAGCACCGAGAAGGCGG + Exonic
1039926745 8:41940907-41940929 CAGTGAGAGCAGCGAGGAGGAGG - Exonic
1040856529 8:51954155-51954177 TTCTGTGAGCAGGGAGAAGCCGG - Intergenic
1041697149 8:60748105-60748127 CTGTGTGAGCAGGAAGATGCAGG + Intronic
1042646031 8:70987594-70987616 CTGTGAGAGCAGCCAGAAGTGGG - Intergenic
1045378639 8:101600786-101600808 CAGTGTGACCAGGGAGAGGCAGG + Intronic
1047749267 8:127867544-127867566 CAGAGTGAGGATCGAAAAGCAGG - Intergenic
1049108817 8:140630029-140630051 CGTTGTGAGCTGGGAGAAGCAGG - Intronic
1049236748 8:141515933-141515955 CAGTGTGAGGAGAGAGACGATGG - Intronic
1051122777 9:13769988-13770010 CAGTGTGAGCAGCCAGGATCAGG + Intergenic
1052030107 9:23618927-23618949 CAGAGTGAGCAGGGAGAAGGAGG - Intergenic
1053416890 9:37952434-37952456 CACTGTGAGCAGCGGGCAGGAGG + Intronic
1057169592 9:92953513-92953535 CAGTGTGAGCAGCGAGAAGCTGG - Intronic
1057204661 9:93164091-93164113 CAGAGTGTCCAGGGAGAAGCTGG - Intergenic
1061543953 9:131293209-131293231 CACGGTGAGCAGCGAGGAGTGGG - Intronic
1062121995 9:134838864-134838886 CAGTGGCAGCAGCGTGGAGCTGG + Intronic
1062614441 9:137389666-137389688 CAGTGAGACCAGCAAGGAGCTGG + Intronic
1203659798 Un_KI270753v1:31255-31277 CAGTGTCAGCAGAGATCAGCGGG + Intergenic
1185773435 X:2783477-2783499 CAGGCAGAGCAGCGTGAAGCTGG + Intronic
1188057266 X:25555731-25555753 CTGTGGGAGCAGGGAGAGGCGGG - Intergenic
1189158980 X:38791134-38791156 GAATGTGAGCAGAGAGAAGATGG - Intergenic
1193840650 X:86404597-86404619 CAGTGAAAGCAGCCAGAAGCAGG - Intronic
1194182789 X:90734651-90734673 CTGTGAAAGCAGCCAGAAGCAGG + Intergenic
1194212277 X:91083094-91083116 CATTGTGGGCAGTGAGAAGGAGG + Intergenic
1195406678 X:104522422-104522444 AAGTGTCAGCAGGGAAAAGCAGG - Intergenic
1197782765 X:130173398-130173420 CAGTTTGACCAGCAAGAAGGAGG - Intronic
1197997143 X:132389779-132389801 CAGTGTGATCACTGAGAACCAGG - Intronic
1198271649 X:135061376-135061398 CAGTGGGAGCAGCTAGGAGGGGG - Intergenic
1199762135 X:150913029-150913051 CAGTGGGACCAGGGAGCAGCTGG - Intergenic
1200216681 X:154371243-154371265 CATTTTGAGGCGCGAGAAGCCGG + Exonic
1200247348 X:154533231-154533253 CAGGGTGAGCAGAGCCAAGCAGG - Intronic
1200529408 Y:4316606-4316628 CTGTGAAAGCAGCCAGAAGCAGG + Intergenic
1201296438 Y:12467085-12467107 CAGGCAGAGCAGCGTGAAGCTGG - Intergenic